Q2: (A)- Write A program that computes Z=[(CL)*+(CH)*J/BL, places the result (Z) in the BX register. Make use of a subroutine named SQUARE that squares the contents of the DL register and places the result in the DX register.
Q: The ADD and SUB operators affect all the status flags according to the result of the operation. Give…
A: The mov operation does not cause any change in the status flags. add and sub can affect all status…
Q: 2-Write a program to find the complement of 2-byte memory location without using NOT instruction.
A: Write a program to find the complement of 2-byte memory location without using NOT instruction.
Q: JumpOffset X This instruction will jump to the address calculated by adding the given address, X, to…
A: The answer is
Q: C. MULTIPLICATION ALGORITHM a) Start the program b) Allocate some space for the result in data…
A: According to the information given:- We have to perform Multiplication program in EMU8086
Q: Search PROC ; save a copy of the registers except eax in the stack ; Implement Search here…
A: Actually, registers are used to stores the data/information.
Q: Complete the following statement: With the CMP instruction O no operands are modified the source…
A: Introduction: Here we are required to complete the given statement which states "With the CMP…
Q: 3- If AX=(BA78). Write a program that finds the value of AX after executing each instruction in…
A: Given AX = (BA78) To write a program that finds the value of AX after executing each…
Q: Write out an example of a memory write, and a memory read using indirect memory access using the BP…
A: The processing of operands is required by the most of assembly language instructions. The operand…
Q: 53- write an instruction sequence that generate a byte-size integer in the memory location defined…
A: (RESULT) = (AL). (NUM1) + (AL).(NUM2---) + (BL) NOT [NUM2] ;(NUM2) <-- (NUM2---) MOV CL, AL AND…
Q: :Q1/ Load the registers by the data blow DS 80C1L SS 2001L CS 10011, AX 0991L BX 500OLL, SI 22011,…
A: the answer is given below :
Q: Implement the following high-level code segments. Assume the integer variables g ,h ,m ,and r are in…
A: The values of integer variables g, h, m and r are are stored in registered in the following manner:…
Q: True or false is the following statement: The size of the flag register in 8088 microprocessor is 9…
A: The computer looks like a Super-highway with many of the data and control lines of running in…
Q: Need assembly file for emulator 8086 Problem 1: Initialize your data segment starting from…
A: Ans: DecimalFormat df = new DecimalFormat("#.####");df.setRoundingMode(RoundingMode.CEILING);for…
Q: 2-Write the program to compute (W) from the following equation X x Y W = Microprocessor %3D Z
A: you have not mentioned programming language I am going to solve this question using the C language…
Q: 1) Rebuild the following instructions: a) AND AL,0O0H
A: It is defined as a controlling unit of a micro-computer, fabricated on a small chip capable of…
Q: True or false is the following statement: The number of registers in the 8088/8086 microprocessor is…
A: False, because The 8088/8086 includes has four 16-bit data registers (AX, BX, CX and DX)
Q: Write a sequence of statements that use only PUSH and POP instructions to exchange the values in the…
A: ECX: It is a register which is used in performing various arithmetic and logical operations in…
Q: 1) Rebuild the following instructions: a) TEST AX,BX b) NEG SI
A: It is used used to transfer the data from the source operand to the destination operand. MOV M,…
Q: 5- Execute the below instructions, display the contents of the registers and explain the results.…
A: According to the information given:- we have to execute the given code.
Q: What does the ADD instruction in the strend subroutine do? O It calculates the address of the next…
A: Strend Return a pointer to the end of a null-terminated string. According to above line strend is…
Q: Find C, and Z flags after executing the compare instruction in each of the following codes:…
A: Zero flag will be 1 ,while carry flag will be 0. LDI :It loads the instruction in the register.…
Q: (True/False): The following instruction is invalid: inc [esi]
A: Answer: The following is the given instruction: inc[esi] The mnemonic INC increments the value of…
Q: What will be the value of the destination operand after each of the following instructions execute…
A: Solution 4) The correct value of the destination operand after each of the instructions executed in…
Q: 1) - Find the contents of register R20 after each of the following codes executed. Also, indicate…
A: Solution: Z flag: It is stored in a dedicated register,mainly called status register or flag…
Q: Assume AL=23h; CL=05. Write the content of AL after ROL AL, CL - showing the calculation steps.…
A: solution :STC − Used to set carry flag ##CF to 1ROL − Used to rotate bits of byte/word _towards the…
Q: ASSEMBLY with irvine32.inc Write a procedure called add3, which takes it three parameters from the…
A: Take three parameters in the stack. Add these numbers. Return the sum. print Success in the end.
Q: Exercise: Write the following equation as a C++ expression and state the evaluation of the binary…
A: Algorithm: Start Read x,y values Calculate…
Q: Assume that the address for integer i is baseaddress+4 and the address for a[0] is baseaddress+8.…
A: The answer is given below
Q: Q1: If DX contains 81FEH and CX contains 1986H, explain the effect of the following instructions on…
A: i) SUB DX, CX
Q: (ADD D,S) INSTRUCTION IS THE SAME AS THE FOLLOWING INSTRUCTIONS COMPILATION Select one: a. mov al.1…
A: C. move al,o add D,S
Q: Select the instruction that gives 100 as an output char x='V',y='s'z="7', cout<<isupper(y); *…
A: isupper(y) returns non-zero value if y is upper case else returns 0 Given y is lower case, so…
Q: Assume AL=23h; CL=05. Write the content of AL after ROL AL, CL- showing the calculation steps.…
A: STC instruction will set the carry flag initially.
Q: destination register after each of the following instructions executes in sequence, given that CL,…
A: Shift and Rotate Instructions Shifting means moving left and right the bits inside an…
Q: Write a program that calculates the following expression, using registers: EAX = (EAX + EBX) − (ECX…
A: Write a program that calculates the following expression, using registers: EAX = (EAX + EBX) − (ECX…
Q: Write a short code segment. Make your code as short as possible. Write a series of instructions that…
A: Given that write a short code segment . Make your code as short as possible. write a series of…
Q: (True/False): The CALL instruction pushes the offset of the instruction following theCALL on the…
A: The “CALL” instruction is used to invoke a procedure. It pushes the instruction's “OFFSET” following…
Q: Take a look at the following assembly code. Which of the following describes what is going on in the…
A: The correct choice for the above assembly code is mentioned below
Q: (True/False): The RET instruction pops the top of the stack into the instruction pointer
A: Explanation: The RET instruction stands for return from procedure. The RET instruction pops the top…
Q: 8. If BX contains 5474H, what is the value in BX after the following instruction? ADD BH, BL
A: As per the question statement, We need to find the value of BX Register. Note: As per guidelines, I…
Q: 1) Rebuild the following instructions: a) AND AL,00H
A: It is used to transfer the data from the source operand to the destination operand. MOV Rd, M Rd…
Q: If AX=(BA78). Write a program that finds the value of AX after executing each instruction in figure…
A:
Q: The stack pointer is stored in which register? %rpi %rbp %rsi %rsp Not stored in a register.
A: The answer is given below...
Q: ( Longest string of 1's in a word of data-put the result into register R5 ( Longest string of O's in…
A: Please check the solution below
Q: Q3) Write program to load the content of memory location Ox0700 into register R3
A: Solution has been provided in below step.
Q: :Q1/ Load the registers by the data blow DS 80CIL SS 2001L CS 10011, AX 0991L BX 50OLL, SI 22011,…
A: the answer is given below :
Q: Convert the following symbolic microoperations into register transfer statements. Maintain the order…
A: Convert the following symbolic microoperations into register transfer statements. Maintain the order…
Q: Q:find the actual address for the following instruction assume X=38 and ?=R index=DCE8 LOAD X(Ri), A…
A: Given data: R index = DCE8 X = 38 Now find the actual address. The instruction is: LOAD X(Ri), A
Q: 5. Below shows a sequence of instructions, give the result of accumulator before and after the DA…
A: Since you are asking multiple questions, we are answering first question for you. If you want…
Step by step
Solved in 2 steps
- q1 )in assembly language (emu 8086x)....Write a program where user will enter a string with maximum size 10 characters, you will read the string until he presses space and swap between 2 characters. Input: Hello 4 2 Output: Hlleo q2) in assembly language(emu 8086x....User will enter an even number N and a count M, you should list the M even and the M odd numbers that follows the given number N N between 0 – 2 M between 2 - 4 Input: 23 Output: 4 68357 q3) in assembly language (emu 8086x)....Write Assembly Program that takes from the user 5 integers and multiplies (Using Shift) even or odd integers by 2 depending on user choice. Input: Enter the array: 37405 Even or Odd: E Output: New Array: 3 7 805 Input: Enter the array: 3 7405 Even or Odd: O Output: New Array: 6 14 4 0 103. Show the stack with all activation record instances, including static and dynamic chains, when execution reaches position 1 in the following skeletal program. Assume bigsub is at level 1. function bigsub() { function a(flag) { function b() { *** a(false); } // end of b *** *** if (flag) b(); else c(); } // end of a function c() { function d() { <--- *** } // end of d d(); } // end of c *** 2 a(true); } // end of bigsub The calling sequence for this program for execution to reach dis bigsub calls a a calls b 12C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
- Language: JAVA Problem 1: Decimal to Binary Conversion Write a program that takes an integer value as an input and converts that value to its binary representation; for instance, if the user inputs 17, then the output will be 10001. Do not forget to check for valid input, which means if the user inputs a type of data other than an integer re-prompt the user to enter a valid value. The output binary number can be a string. Sample input and output: Enter an integer > a You entered an invalid type. Try again. Enter an integer > 17 10001Subject Topic: Logic Formulation using Flowchart and PseudocodeProblem: LoopingCreate a program flowchart that generates and displays the Fibonacci sequencenumbers of n(as input). In Fibonacci, the current third number is the sum of two previousnumbersSample input/output dialogue:Enter a no. 9Fibonacci series : 1 1 2 3 5 8 13 21 34Please put level 1 flow chart and pseudocode here....REPETITION CONTROL STRUCTURE (FOR) Instruction: Write a Java program that reads a positive, non-zero integer as input and checks if the integer is deficient, perfect, or abundant. A positive, non-zero integer, N, is said to be perfect if the sum of its positive proper divisors (i.e., the positive integers, other than N itself, that divide N exactly) is equal to the number itself. If this sum is less than N, the number is said to be deficient. If the sum is greater than N, the number is said to be abundant. The first few perfect numbers are 6, 28, 496, and 8128. Illustrations: Number Factors of the number less than itself Sum of Factors 3, 2, 1 14, 7, 4, 2, 1 6 6 28 28 For example, the number 6 is perfect, since 6 = 1 + 2 + 3, the number 8 is deficient, since 8 >1 + 2 + 4, while the number 12 is abundant, since 12<1 + 2 + 3 + 4 + 6. Sample Input/Output: Depicted below are sample outputs when the program is executed (the items in bold characters are input from the user, while the items…
- PaoBLEM# 39 I Simplify the following expressions using Boolean algebra. Cite the laws and therorems used. • AB + A(CD + CD') • (BC' + A'D) (AB' + CD')English Language Calculator Build a simple “English Language” calculator that does the following: Takes three inputs from the keyboard Two of the inputs are single-digit numbers (0 to 9) The third input is a char from the keyboard, representing one of the five operations from the keyboard: + (addition) - (subtraction) * (multiplication) / (division) ^ (exponentiation) Output the description of the operation in plain English, as well as the numeric result Input and Output Instruction for the Calculator If the two input numbers are 5 and 3, and the operation is *, then the output should be five multiplied by three is 15 Note that the result is given as a number, not a word. If the two numbers are 2 and 9, and the operation is -, then the output should be two minus nine is -7 If the two numbers are 5 and 2, and the operation is ^, then the output should be five to the power two is 25 Hint: To perform the exponentiation, use the pow method of the Math class. If the two…When you perform arithmetic operations with operands of different types, such as adding an int and a float, ____________. C# chooses a unifying type for the result you must choose a unifying type for the result you must provide a cast you receive an error message
- (Numerical) Write a program that tests the effectiveness of the rand() library function. Start by initializing 10 counters to 0, and then generate a large number of pseudorandom integers between 0 and 9. Each time a 0 occurs, increment the variable you have designated as the zero counter; when a 1 occurs, increment the counter variable that’s keeping count of the 1s that occur; and so on. Finally, display the number of 0s, 1s, 2s, and so on that occurred and the percentage of the time they occurred.PART 2: REPETITION CONTROL STRUCTURE (WHILE, DO-WHILE) Instruction: A mathematician named Ulam proposed generating a sequence of numbers from any positive integer N greater than 1 using the following procedure: If N is 1, stop. If N is even, replace it with N/2. If N is odd, replace it with 3 * N + 1. Continue with this process until N reaches 1. Here are some examples of the Ulam sequence for the first few integers. 2, 1 3, 10, 5, 16, 8, 4, 2, 1 4, 2, 1 5, 16, 8, 4, 2, 1 6, 3, 10, 5, 16, 8, 4, 2, 1 Create a java program using while/do-while that accepts as input an integer value N (assume N> 1) and prints out the Ulam sequence that begins with the input value N. Sample Input/Output: Depicted below are sample outputs when the program is executed (the items in bold characters are input from the user, while the items in bold italic are calculated and printed by the program): Input N: 14 Ulam Sequence: 14, 7, 22, 11, 34, 17, 52, 26, 13, 40, 20, 10, 5, 16, 8, 4, 2, 1 Input N: 5 Ulam…Programming Language: Python 4. Write a Python function that will take a positive integer n from the user as an argument and returns the largest power of two greater than or equal to n.
