Provide the sequences of the template and coding strands of a DNA double helix that was used to produce this RNA: 5’-GUUACCGACUAU. Be sure to label the 5’ and 3’ ends.
Q: 2.List four characteristics of water that are emergent properties resulting from hydrogen bonding
A: Water is a colourless, tasteless, and odourless liquid made up of hydrogen and oxygen molecules. It…
Q: In a cloning experiment a fragment of DNA is ligated with a vector such as a plasmid. Following the…
A: The transformation step is an important part of cloning experiments because it helps us get the…
Q: Which of the following represents a SINGLE CHROMOSOME? Look at all the choices before answering. A B…
A: Thread-like structures present inside the nucleus of each cell consisting of DNA molecules are…
Q: How are fats digested mobilized and transported inside the body in the fed and fasted states
A: INTRODUCTION Fats are one of the three macronutrients found in the human diet, alongside…
Q: macroscopically describe the appearance of a normal and abnormal stool
A: Stool, or feces as they are commonly known, has many different properties depending on the…
Q: Explain the principle behind the streak plate method.
A: Streak plate method This method is a used in microbiology for isolating single colonies of…
Q: Dolphins have 44 chromosomes. How many chromatids are there in the following cells and/or cell…
A: A skin cell is a type of somatic cell, these are diploid cells having two sets of chromosomes.…
Q: Microvilli are commonly seen in cells involved in absorption of materials (like intestinal cells)…
A: INTRODUCTION Microvilli are microscopic projections on the surface of cells that increase the…
Q: What other precautionary measures must be observed in the collection of fecal specimens?
A: 1) The collection of fecal specimens is a common medical procedure that is used to diagnose various…
Q: Write a lonintroduction about Renewable Energy Systems
A: Introduction :- Renewable energy systems refer to the use of sustainable energy sources that are…
Q: QUESTION 2 In the fermentation part of this lab, we are measuring the production of what product? O…
A: Introduction : Even without oxygen, glucose can still be converted into energy via the anaerobic…
Q: What is the function of the chemical tar?
A: Tar: Through destructive distillation, tar is a viscous liquid made up of free carbon and…
Q: If the DNA that is about to be replicated has the following sequence: 5' ATTGCACTTAGGAATT 3' 3'…
A: INTRODUCTION The genetic material contained in all living things is called DNA.It is a…
Q: Do you think that the term “closest evolutionary relationship” and “most common ancestor” are alike?…
A: Yes, the terms "closest evolutionary relationship" and "most recent common ancestor" are similar in…
Q: Why is DNA replication important to the growth and development of a multi-cellular organism? a of…
A: Introduction :- DNA replication is the process by which a cell makes a copy of its DNA in…
Q: Genetic diversity is generated during meiosis. State the two processes by which recombination of…
A: Genetic recombination occurs through the following processes during meiosis I
Q: Which of the following enzymes is mismatched? Ochymotrypsin; protein O trypsin; starch Olipase; fat…
A: Enzymes are proteins which act as catalysts in biological reactions and they play a critical role in…
Q: How will you prepare a good fecal smear for microscopic examination?
A: A stool sample is tested in a lab using a faecal smear. The purpose of this test is to look for…
Q: n dogs, the trait for coat color influences the trait for short legs. Black coat (B) is dominant to…
A: Introduction: Genetic inheritance is the process by which genetic information is passed from one…
Q: Draw and label the events occurring in the stages of cell division for a cell that is 2n = 46 and…
A: Introduction : The fundamental structural and functional component of every living thing is the…
Q: Lipids are hydrophilic. True False
A: Introduction Lipids are a diverse class of organic compounds that are characterized by their…
Q: humans, Rh-positive individuals have the Rh antigen on their red blood cells, while Rh-negative…
A: According to Hardy Weinberg equation p2 + q2 + 2pq =1 and p + q=1 Where, p= frequency of the…
Q: Relate the chemical structure of phospholipids to their physical properties and uses. Use a diagram…
A: Phospholipids are esters comprising two fatty acid molecules joined to a glycerol molecule and a…
Q: Dolphins have 44 chromosomes. How many chromatids are there in the following cells and/
A: Introduction: The series of activities that a cell goes through as it develops and splits into two…
Q: In mammals, the developing fetus obtains O₂ from its mother's blood via the placenta. For this to
A: The primary oxygen carrier protein in the developing human is called foetal haemoglobin, also known…
Q: How does ampicillin kill nonresistant cells?
A: Ampicillin is an antibiotic derived from penicillin and is very effective in killing gram-positive…
Q: n mice, the Ay allele of the agouti gene is recessive lethal, but it is dominant to wild type for…
A: Introduction In genetics, dominance and recessiveness refer to the relationship between two or more…
Q: Cholesterol is an example of what type of lipid?
A: Option B: Steroid
Q: flew from Montreal to Ottawa to speak with Prime Minister Trudeau recently flew with President Biden…
A: The red-vented bulbul is a member of the Bulbul amily of Passerines. It has a short crest and a…
Q: Describe the product that you have chosen (2) Comment on the information provided on the label
A: (1) Product that you have chosen is cod liver oil A dietary supplement called cod liver oil is made…
Q: Do you agree with the food industry not wanting the public to know about FATS? what are your…
A: The topic of fats in food has been a subject of much discussion and debate in recent years. Many…
Q: Which one kills microbes by altering and oxidizing proteins and membranes? a.Ag…
A: The options given in the question are either antiseptic or disinfectant. Disinfectants are used to…
Q: Explain well the principle behind the streak plate method.
A: In microbiology, there are two types of cultures, pure culture and mixed culture. In pure culture,…
Q: Describe the significance of clinical laboratories being regulated and registered in the…
A: Introduction :- Clinical laboratories are facilities that perform medical tests on specimens taken…
Q: My options are 1/4, 3/16, 9/16 or 1/16
A: This is a dihybrid cross taking into consideration two characters such as coat colour and length of…
Q: QUESTION 9 In winter many organisms adapt to the cold temperatures by decreasing the effective Tm of…
A: Tm is known as the melting temperature. Poikilothermic organisms are those that cannot maintain…
Q: Explain the difference between assimilatory nitrate reduction and dissimilatory nitrate reduction.
A: Introduction Bacteria are single-celled microorganisms that belong to the kingdom Monera. They are…
Q: What is the function of the chemical turpentine
A: Introduction: Coniferous trees, particularly those of the species Pinus, produce turpentine, a…
Q: Explain the potential dangers, risks, and harms of combining marijuana with each of the following…
A: Introduction Marijuana, also known as cannabis, is a naturally occurring plant that contains…
Q: Which organelle has more than one layer (state how many layers) of membrane? List the 3 types of…
A: Cell: Biology's branch of cell biology, often known as cellular biology or cytology, focuses on the…
Q: Do Now: Heterozygous is also called____________?
A: Heterozygous is commonly referred to as a carrier, meaning an individual who possesses one copy of a…
Q: The long horns on Texas longhorn cattle are an example of - natural selection - genetic drift -…
A: Texas Longhorns are descended from the cattle that Christopher Columbus carried to Hispaniola in…
Q: When the concentration of H+ ions in a solution decreases, a buffer maintains the pH of a solution…
A: INTRODUCTION The concentration of any given ion in solution is a measure of the amount of that ion…
Q: What is/are responsible for the offensive odor of stool? What is the normal color of babies’ stool?…
A: The color of stool can be an indicator of various factors, including digestive health and the…
Q: Why are people who consume many of their carbohydrates in the form of high-fructose corn syrup…
A: Starch: A polymeric carbohydrate known as starch or amylum is made up of many glucose units…
Q: Which of the following is a way to distinguish between DNA and RNA? The number of carbon atoms in…
A: DNA and RNA are nucleic acids that have different roles in the cell. Both are made up of…
Q: Concerning the reciprocal regulation of phosphofructokinase and fructose-1,6-bisphosphatase in the…
A: Phosphofructokinase and fructose-1,6-bisphosphatase are key enzymes involved in regulating…
Q: 4. T/F about BOD ● A measure of dissolved oxygen in 5 days at 20 deg Measure of organic matter in…
A: Introduction Biological Oxygen Demand (BOD) is a measure of the amount of oxygen that is consumed…
Q: Quest Whi
A: Introduction: A sense organ is a specialized structure in the body that is responsible for detecting…
Q: Q 2 of 15 New parents notice that their daughter's head is much bigger than the rest of her body in…
A: Introduction :- A sonogram, also known as an ultrasound, is a medical imaging test that uses…
Provide the sequences of the template and coding strands of a DNA double helix that was used to
produce this RNA: 5’-GUUACCGACUAU. Be sure to label the 5’ and 3’ ends.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.You are working in a research lab studying human Peptide Z, which is a short protein that plays a key role in responding to SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide Z (below), but she neglects to tell you which are the coding and non-coding strands of this DNA before leaving on a six-month sabbatical. 5'-AGA CCC ATG CCT CAG CAG TTC TTT GGA TTA ATG TAA-3' 3'-TCT GGG TẠC GGA GTC GTC AAG AAA CCT AAT TẠC ATT-5' Using your understand of transcription, translation, and the codon table below, determine if the top strand or bottom strand is the template strand of the Peptide Z gene. (Enter either top strand or bottom strand.) What is the sequence of the RNA that encodes Peptide Z? Note that the entire DNA sequence is transcribed. 5' - - 3' What is the amino acid sequence of Peptide Z? Make sure you indicate the carboxyl-terminus and amino-terminus with C and N, respectively.The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strandGiven the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA, tRNA, and protein using the figure that will post here
- For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also labeled, what are the first 3 nucleotides of the RNA transcribed from this sequence? +1 5.10 +10 3 GAGCGACATAATACGATTAT 5' AUA 3' 5' AAU 3' 5' UAU 3' 5' UUA 3' 5' CUA 3'The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.For the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate