Q: According to the endosymbiotic theory of the origin of eukaryotic cells, how did chloroplasts…
A: The endosymbiotic theory is a widely accepted explanation for how eukaryotic cells, which are cells…
Q: what medical supplies are needed for a cancer program
A: The objective of the question is to identify the medical supplies that are essential for a cancer…
Q: Which of the following conditions were kept the same between the control group and the experimental…
A: In the given experiment the researcher try to find the effect of temperature on seed germination.…
Q: the varieties in pH level of the pancreas and how it will affect the TPU material of the scaffold
A: The pH levels in the pancreas can generally be categorized into different regions:1. Ductal System…
Q: The figure illustrates the receptive field of an OFF-center ganglion cell under different light…
A: There are two sorts of ganglion cells: ON-center and OFF-center. An ON-center cell is stimulated…
Q: Choose the best description of a desert ecosystem that has remained stable for hundreds of years.…
A: The objective of the question is to identify the correct description of a desert ecosystem that has…
Q: Your colleague is studying a newly discovered organism. She is becoming increasingly convinced that…
A: The features that cause me to exclude the organism from the arthropod grouping are:pseudocoel,…
Q: The formation of a tough wall of sporopollenin around the male gametophyte leads to the production…
A: The question is asking about the end product of the formation of a tough wall of sporopollenin…
Q: Which of the following is NOT part of the male reproductive parts of a flower? Anthers Sperm…
A: The question is asking us to identify which of the given options is not a part of the male…
Q: HDL-R: HDLs carry cholesterol to the liver for elimination. Liver cells respond to estrogen to…
A: The objective of the question is to predict the gene expression patterns in immune B cells using a…
Q: Match each of the following statements that describe either: A, small molecule transmi a. Dense core…
A: Neurotransmitters are essential for inter-neuronal communication, and they fall into two main…
Q: In seed-bearing plants, the _______________ develops into the seed following fertilization The…
A: The objective of the question is to identify which part of a seed-bearing plant develops into the…
Q: In order to allow the diffusion of islet beta cells encapsulated within the medical scaffold into…
A:
Q: Which of the following statements concerning enhancer DNA sequences is true? Group of answer choices…
A: b. Enhancers DNA sequences are close to the genes they activate (via looping) even if they are very…
Q: Describe the roles of the retina and the optic nerve in vision.
A: The capacity to recognize patterns of light in the external world and translate them into visual…
Q: Mission 4.1.2. Choose the 3 maternal and 3 paternal chromosomes needed to breed a female drake with…
A: Alleles are the different forms of the same gene located at the same location on a chromosome. The…
Q: Why the use of vouchers in the article lessons from sexual and reproductive health voucher programs…
A: Vouchers have been utilized as a strategy in sexual and reproductive health (SRH) programs to…
Q: What traits do bryophytes and tracheophytes have in common? Check all that you think apply.A) they…
A: The question is asking to identify the common traits between bryophytes and tracheophytes.…
Q: Consider figure 22.5b. The following statements are true. Choose all applicable options. a) Hair…
A: Humans and chimpanzees followed divergent evolutions in which both have a common ancestry but due…
Q: Which of the following is NOT a characteristic of the gametophyte stage of the flowering plant?…
A: The objective of the question is to identify the statement that does not correctly describe the…
Q: At higher magnifications, the millimeter markings may be too far apart to appear together in the…
A: In this initial stage, our objective is to comprehend and assess the provided formula designed for…
Q: What is the field of view under the 100X objective of the microscope used in the previous question?…
A: In this initial phase, our goal is to understand and evaluate the provided formula designed to…
Q: From the choices below, identify those that are characteristics of all living things. (There may be…
A: It would seem that there would never be a requirement to define what life's purpose is. Let me ask…
Q: Learn It: Describe the common features of all lifeforms. consumers. As energy flows from one…
A: Answer:- The correct option is 'D' i.e Inheritance.Inheritance refers to the transmission of genetic…
Q: Cultured cells were treated with a compound in early Gap 1 (G₁) phase resulting to arrest before…
A: The objective of the question is to identify the most plausible mechanism of cell cycle arrest in…
Q: 1. What scientific terms describe the cellular morphology and arrangement of Staphylococcus…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: . What color does an acid-fast cell stain? 2. Identify two diseases that are caused by acid-fast…
A: By adding color to particular structures or components of biological specimens, staining is a…
Q: What are the 4 major steps in Gram Staining and what is the role of each reagent?
A: The objective of this question is to understand the four major steps involved in Gram staining, a…
Q: Which of the follow general transcription factors contains the protein TBP and binds to TATA box…
A: The correct answer is: a. TFIID TFIID is a general transcription factor that contains the…
Q: Irene hurt her knee when she fell while learning a new snowboarding trick. She is already starting…
A: The process of communication from one neuron to the other involves the action of chemical…
Q: What is the name given to a biological catalyst? O protein O enzyme ORNA O electrolyte O…
A: The objective of the question is to identify the correct term for a biological catalyst among the…
Q: Stem cells with their totipotent capacity have determinate cleavage. True False
A: The question is asking whether stem cells, which are known for their totipotent capacity, have…
Q: What challenges could be faced in getting all or some of inputs or resources for cancer programs
A: The objective of the question is to understand the potential challenges that could be encountered…
Q: Oxycodone has a high affinity for the mu receptor, and when it binds to this receptor, it produces a…
A: Oxycodone is a type of opioid drug used to relieve pain. Like any other opioid drug it may bind to…
Q: write about the Role of the gut microbiota in nutrition and health.
A: The variety of microorganisms present in and on all multicellular animals, including plants, known…
Q: Tagmata are segments of the body that represent two or more previous body segments fused together.…
A: The objective of the question is to verify the definition of 'Tagmata' in the context of biology.
Q: Differentiate between Phylum Porifera and Clade Eumetazoa. A)Poriferans are only haploid during…
A: The question is asking to differentiate between two biological classifications: Phylum Porifera and…
Q: 4. Can you cure viral pneumonia?
A: Viral pneumonia is a term used to describe infection of lungs which is caused by a virus.An Example…
Q: Plant stem cells such as those found in cambium tissues are able to -fight microbial invaders by…
A: The question is asking about the capabilities of plant stem cells, specifically those found in…
Q: In Hermann-Hering grid, there appears to be phantom dots in the intersections (picture below).…
A: The Hermann-Hering grid could be a classic optical illusion that has been broadly considered within…
Q: Which of the following conversions require more than one step? 1. Alanine Ⓡpyruvate 2. Aspartate…
A: Solution:- The 5th option is correct i.e Proline ®glutamate.Reason- Conversion of Proline ®glutamate…
Q: 3. Identify the variables (dependent/independent), and research design type…
A: Dependent Variable: Self-reported stress levelsIndependent Variable: Levels of physical…
Q: Put the following in the correct order of the most direct visual processing pathway from eyes to…
A: The eyes are important sensory organs for vision in animals. The visual system consists of eyes and…
Q: You are diving off the coast of an island. Since you are a very good diver, you can go quite deep.…
A: The objective of the question is to identify the phylum of algae that is most likely to be found in…
Q: In homospory, the megaspore develops into female gametophyte True or False
A: The objective of the question is to determine whether the statement 'In homospory, the megaspore…
Q: Match the description with the organism Description- -the fused cells possess a total of two…
A: The objective of the question is to match the given descriptions with the correct organisms. This…
Q: Belinda!” called Kyle, running to catch up to her. Belinda turned around and waited for him.…
A: Gram staining procedure is a testing procedure for bacteria. In this procedure, few chemicals are…
Q: Which of the following is a well. known risk factor for pregnancy & birth related problems and…
A: Pregnancy is the state of the female body when it carries one or more offspring after reproduction.
Q: Why are the X and Y chromosomes not considered homologous even though they recombine at the PAR…
A: Sex chromosomes are a type of chromosome that participates in sex determination. Humans and most…
Q: Species Type Number Sugar maple Tree 5 Eastern hemlock Tree 4 Rhododendron Shrub 11 Day…
A: The objective of this question is to calculate the biodiversity of the plants in the yard using…
Protein-coding sequences are the only highly conserved regions in our genome
True
False
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Since it was deciphered four decades ago, somehave claimed that the genetic code must be a frozen acci-dent, while others have argued that it was shaped by nat-ural selection. A striking feature of the genetic code is itsinherent resistance to the effects of mutation. For example,a change in the third position of a codon often specifies thesame amino acid or one with similar chemical properties.The natural code resists mutation more effectively (is lesssusceptible to error) than most other possible versions, asillustrated in Figure Q1–1. Only one in a million comput-er-generated “random” codes is more error-resistant thanthe natural genetic code. Does the extraordinary mutationresistance of the genetic code argue in favor of its origin asa frozen accident or as a result of natural selection? Explainyour reasoning.
- Given the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letterOne remarkable feature of the genetic code is that amino acids with similar chemical properties often have similar codons. thus codons with U or C as the second nucleotide tend to specify hydrophobic amino acids. Can you suggest a possible explanation for this phenomenon in terms of the early evolution of the protein-synthesis machinery?The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
- Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA, and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 3' TCACAATACAAAGGTGTACTGATCTCATCTCCATAA 5'A crime has occurred, and you are asked to help solve it. A forensics detective brings you a sample from the crime scene of what they believe is the suspect's DNA and asks you for chemical analy Your study of this sample reveals the presence of adenine, thymine, ribose, and uracil, leading you to conclude that the sample is A pure DNA probably a mixture of DNA and RNA C pure RNA probably a mixture of rRNA and mRNA MAR 12 tv MacBook Air DII DD esc F6 F7 F8 F9 F10 F1 F1 F2 F3 F4 F5 &
- The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence encodes a seven amino acid stretch of a protein. 5' ATGCGGAТАААТТААAАТТСС 3' 3' TACGCCTATTTAATTTTAAGG 5' If the third base pair from the left in the DNA sequence were deleted, what type of mutation would this be called? Second Letter G. UUU UUUC UUA UUG Phe UCU UCC UCA UCG UAU UAC UAA UAG Tyr UGU UGC Stop UGA Stop A Stop UGG Trp G Ser Leu CUU C CUC CUA CUG CCU Leu CCC CCA CCG CAU His CGU CGC Arg CGA CGG Pro САС CAA CAG 1st Gin 3rd letter AUU A AUC AUA AUG ACU le ACC ACA Met ACG AAU AAC AAA AAG AGU AGC AGA AGG Asn Ser U letter Thr Lys Arg GUU G GUC GUA GUG GCU GCC GCA GCG Asp GAU GAC GAA GAG GGU GGC GGA GGG Val Ala Gly Glu nonsense O frameshift O dominant missense UCACD CAGU CAG UCACHow many PAM sequences are present in the sequence below? 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG-3' O 2 O 3 O 4 O5 0 6Which of these single strand RNA sequences could form a hairpin secondary structure? 5' AAAAAAAAAAAAAAAAAAA 3' 5' ACACACACACACACACAC 3' 5' CCCGGGGUUUUCCCCGGG 3' 5' UUUUUUUUUCCCCCCCCC 3' 5’ UUUGGGUUUGGGUUUGGG 3’