What phrase best describes the major process component ofevolution?natural selectionO adaptationsurvival of the fittestdescent with modification

Ans: Charles Darwin the British naturalist gave the theory of biological evolution. He defined…

Answered: phase best describes the major process…

phase best describes the major process compon evolution? natural selection O adaptation O survival of the fittest Odescent with modification

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter17: Processes Of Evolution

Section: Chapter Questions

Problem 3SQ

See similar textbooks

Related questions

Q: In the fungus Neurospora, a strain that is auxotrophic for thiamine (mutant allele t) was crossed…

A: Neurospora is an Ascomycete fungus genus. The genus name, which means "nerve spore," refers to the…

Q: Here's a line of DNA code: TACACGCCAGAG Transcribe it: (USE caps, no spaces)

A: The process of transcription in which RNA is synthesized from the DNA strand is carried out by the…

Q: Anatomical regions are sometimes named for the bones that in that region True or false?

A: Q. Anatomical regions are sometimes named for the bones that in that region True or false?

Q: Select one: a. glucose.

A: Respiration is an essential chemical activity carried out by all living creatures, including plants,…

Q: Describe Narwhals and state some great facts and interesting trivias about them.

A: Narwhals It is a medium sized toothed whale. It possess a large tusk from the protruding canine…

Q: Based on our current knowledge of biology on Earth, above what temperature (in °C) would biological…

A: The survival of the living organisms is dependent on various factors in which temperature is one of…

Q: Explain the following areas about (X-ray machines) 1. What are the ingredients the device? 2.…

A: Introduction The X-ray machine is a device that is used in the medical field to diagnose the…

Q: What are the serious long-term health consequences of STDs for young women?

A: Introduction Lifestyle is behavior shown by the person day to day at his/her residence, workplace,…

Q: Name the products of the citric acid cycle.

A: The citric acid cycle is also known as the TCA cycle. The TCA cycle occurs inside the mitochondrial…

Q: A rubbery secreted matrix of proteoglycans and collagen surrounds living cells in______ . a. bone c.…

A: Roadeo glycans are made up of proteins and carbohydrate residues. Mainly ground substance of few…

Q: Adaptations for low oxygen in – inverts, goldfish, turtles

A: Inverts:- all those organisms lacking vertebra column comes under the category of inverts i.e.…

Q: Why is prompt treatment of pelvic inflammatory disease (PID) critical to reproductive health?

A: Introduction Pelvic inflammatory diseases are the diseases caused in the upper reproductive organs.…

Q: Please draw the protein synthesis

A: Introduction Protein synthesis, also known as protein biosynthesis, is a fundamental biological…

Q: 3. How would you manage patient's (eye) condition?

A: Introduction The human eye is the organ of the visual system which has the ability to receive visual…

Q: Z Primate Opposable Thumb? Length of Thumb (cm) Claws or Nails?

A: A primate is any mammal of the group that includes lemurs, lorises, tarsiers, monkeys, apes, and…

Q: The expression levels for two genes measured at four times are: Compute the correlation…

A: The correlation coefficient's size reveals the degree of the link. A correlation of r = -0.2…

Q: What role do hydrogen bonds play in nucleic acid and protien syntheis

A: Although hydrogen bonds are weak covalent connections, they are crucial to the three-dimensional…

Q: If the cell whose nuclear material is shown in figure below continues toward completion of mitosis,…

A: This question is based on the mitosis process of the cell cycle.

Q: Page 5 of 10 761 words mana M m X English (United States)

A: This question is about labelling the diagram of a cell.

Q: How will you check the purity of an isolate?

A: Purity is defined as the absence of impurities in substance or the presence of matter other than…

Q: if there are 1,000,000 bacteria and 90% of them are killed, how many bacteria remain?

A: Bacterial growth is an orderly increase in the quantity of cellular constituents and number. It…

Q: Architect Louis Henri Sullivan coined the phrase, “Form ever follows function.” What do you think he…

A: Louis Henri Sullivan is an American architect also known as the father of skyscrapers and the father…

Q: Write a short paragraph about Mulberry Branches and Their Biological Properties

A: Introduction The genus Morus, which includes numerous species of deciduous trees generally known as…

Q: Where are the Bartholin glands located? What is their function?

A: Introduction Life starts from a single cell called Zygote. A zygote is formed by the fusion of the…

Q: Methods of ATP production –aerobic, anaerobic and other – when are they used, how do they work, how…

A: Most cancer cells undergo aerobic respiration. Cancer cells have significant heterogeneity in…

Q: Characteristics of Each Cell Type Has a Cell Membrane Has Cytoplasm Has Ribosomes Has DNA Form of…

Q: identity the slides with labelling and also mention the important features of this slides

A: Cryptococcus neoformans is a species of small encapsulated yeast that has the ability to cause mild,…

Q: Which of the following is NOT a consequence of the shift to an agricultural way of life?

A: Introduction Agriculture is the practice of cultivating the land to grow crops and obtain food,…

Q: What is the current understanding of hormones in the pathophysiology of prostate cancer?

A: Introduction A tumor is nothing but uncontrolled cell division, which can lead to the formation of…

Q: The study of tissues is called cytology

A: Tissue is defined as group of cells that possess a similar structure and perform a specific…

Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3: The corresponding codon for…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: Explain how mutations in the following proteins might result in either loss of responsiveness to a…

A: Introduction Mutation is a sudden heritable change in our genome or genetic material. Mutation can…

Q: Which cells produce testosterone?

A: Introduction Testosterone is male sex hormone which controls secondary sexual characters and other…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: What are the stages of the life cycle of a housefly

A: The house fly is widespread in both rural and urban settings and can be found in all types of…

Q: The most significant cause of the loss of biodiversity isa. habitat loss.b. pollution.c. exotic…

A: Introduction Biodiversity refers to the availability of the different types of species of different…

Q: Glycolysis, which can occur in all living cells, correctly occurs in the cell structure _____, and…

A: Glycolysis is also known as EMP pathway (Embden - Meyerhof Pathway). It is a universal process. It…

Q: Mention the chemical change that proinsulin undergoes, to be able to act as mature insulin.

A: Pancreas is considered as both exocrine as well as endocrine gland. As an exocrine gland , it helps…

Q: What are the functions of saliva?

A: Saliva is a clear liquid secreted by the salivary glands present in the mouth region. The saliva…

Q: Explain the consequences; a. if simple columnar epithelium replaced non-keratinized stratified…

A: Epithelium:- it is a type of body tissue that usually coverup the internal as well as external…

Q: 1.Which is the correct statement: Speed of protein synthesis > speed of protein folding Speed of…

A: Introduction :- Protein folding is the physical process that converts a protein chain to its natural…

Q: Plz answer questions 1 and 2 only asap

A: Conjunctiva is the membrane that lines the eyelids and covers the white part of the eye. In…

Q: What are bioreactors ? How are large volume of culture maintained and processed in them ?

A: A bioreactor is a system that enables organisms (such as yeast, bacteria, or animal cells) to…

Q: How long would the peptide be that is translated from this mRNA sequence: AUGGGCUACCGA ? Group of…

A: Introduction :- In molecular biology, messenger ribonucleic acid is a single-stranded RNA molecule…

Q: What vaccines are available to prevent viral hepatitis?

A: Introduction Hepatitis virus as the name suggests affects the liver, Hepatocytes, and itis means…

Q: Answer briefly and concisely. Thank you! What have you observed regarding the brightness of the…

A: A microscope is a laboratory instrument used to examine objects that are too small to be seen by the…

Q: give example for food record/diary of weighed quantities of food consumed by an individual for 4 day

A: Weighed food diaries, often known as diet diaries or food records, are prospective dietary…

Q: Which conditions would NOT lead to good preservation of a dead hominin skeleton? Group of answer…

A: Introduction A soil ecosystem is an example of a complex ecosystem as it contains a lot of living,…

Q: While proper filtration technique showed the location of the dye, it did not explain the process by…

A: Active transport is the movement of molecules across a cell membrane from a lower concentration…

Q: Show in a diagram how energy from sunlight is used to produce ATP.

A: Introduction ATP as we know stands for Adenosine Tri-Phosphate. It is the main energy currency in…

Concept explainers

Sexual Motivation

Sexual motivation refers to a person's overall desire for sexual activity. It is an unusual motivation. Generally, among lower animals, the term 'drive' is commonly referred to as sexual motivation. It means a certain internal force drags the animal to be involved in reproductive behavior. On the contrary, humans are not simply driven by any internal force; rather, the sexual motivation in humans is due to several factors such as biological (hormones, genes), environmental (familial upbringing, chemical exposure) and physiological factors (culture, desire) which further determine engagement in sexual activities.

Question

What phrase best describes the major process component of
evolution?
natural selection
O adaptation
survival of the fittest
descent with modification

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

When the better adapted organisms survive to pass traits along to offspring. This is known as O Evolution O Natural Selection Extinction O Artifical Selection
Natural selection can lead to adaptations over time. O True O False
What is NOT a product of evolution? O Adaptations O The great chain of being O Vestigial organs O Biodiversity
a statement of how sexual selection differs from natural selection has to be a statement that is wrrtien in a essay
AM Fri Jun 18 AA A f1.app.edmentum.com E Natural Selection: Mastery Test SnapSolve - Free Doubt Video Solutions and Maths Exer Previous Next O Natural Selection: Mastery Test O Submit Test Drag each tile to the correct location on the table. Decide if each statement is a fact or a misconception about the theory of evolution by natural selection. The theory says that organisms that are better adapted to their environments will have The theory says that natural selection gives organisms everything they The theory proposes that while natural selection acts on individuals, only populations evolve. need to live. higher survival and reproduction rates. The theory explains the origin of life. According to the theory, individual organisms can evolve during their lifespan. The theory suggests that the organisms in a population that are the most well adapted are those that are the largest. Fact Misconception O 2021 Edmentum. All rights reserved.
Which of the following statements is false? ONatural selection can alter a population's mean trait value O Natural selection usually decreases or maintains genetic variation Natural selection always favours rare genotypes O Natural selection acts on the phenotype
The influence of any factor in the total environment tending to produce genetic change from one generation to the next is called. Select one inhertance of acquired characteristics Ob geneticCs Oc natural selection Od mutation
Which of the following statements about natural selection is not true? O Natural selection operates according to differential reproductive success of individuals. O Natural selection usually predominates in small population only. O The cumulative effects of natural selection gives rise to individuals that can survive in a specific environment. O Natural selection results in evolution when individuals with higher survival and reproductive rates pass on these traits to their offspring.
Which of the following increase genetic variation in a population? O Founder effect O Mutations O Natural selection O Sexual reproduction O Bottleneck effect
What type of selection favors one extreme phenotype leading to loss of genetic variation? Select one: O Directional O Disruptive O Balancing O Stabilizing O Adaptation Which of the following is true about natural selection? Select one: O Can generate totally new genetic material O Is directed toward a goal O Can lead to perfection O Is not the only process that leads to evolution O Changes Individuals
As shown in the figure, several types of crops descended from the same ancestral species. This is likely an example of: Brassica oleracea Selection for terminal buds Cabbage Selection Selection for lateral for stem buds Brussels sprouts Kohlrabi Selection for leaves Kale Selection for stems and flowers Selection for flower clusters Broccoli Cauliflower
Which of the following is true about natural selection? O It can only act on traits that are heritable and show variation. It always favors large, strong individuals. It allows species to choose what adaptations are passed on to offspring. O It acts on individual organisms, helping them become better adapted to their environment.