On July 16, 1969, the Apollo 11 spacecraft launched from Earth. Write out a program to simulate a one-minute launch countdown, starting from 60 and counting down to 1, followed by the word “LIFTOFF!!!”. You must import the time module to use its sleep function to make the countdown realistic: import time # This will make the computer wait for 1 second: time.sleep(1) The output must look like the following when you test your program: 60 59 58 … 3 2 1 LIFTOFF!!!
Q: Write a program in java to accept basicpay,hra, from the employee. Calculate grosspay which is…
A: Given:
Q: Create a program in python wages.py that assumes people are paid double time for hours over 60. They…
A: The required Python code is: import randomimport winsound hourRate=float(input("Enter the hourly…
Q: Write a program that will help an elementary school student learn multiplication. Use the…
A: #include <stdio.h>#include <stdlib.h>#include<time.h> //Random one digit positive…
Q: Create a new class called Simplecalc. In this class, implement a program that asks the user to enter…
A: // Java program for simple calculator import java.io.*;import java.lang.*;import…
Q: A supermarket needs to develop software to encourage regular customers. For this, the customer needs…
A: Solution: Given, A supermarket needs to develop software to encourage regular customers. For…
Q: Write a program in c ++ that inputs four numbers separated by spaces. The program should count how…
A:
Q: Write a program that generates a gradebook similar to the jenzabar grade book output: student name…
A: Note, as you haven't provided any programming language in the question so, I am using python…
Q: You are teaching a class and decide to curve the exam grades. Write a Java program that reads…
A: import java.util.*;class Test97 { public static void main(String args[]) { Scanner sc = new…
Q: Write a program in the Java code that modifies the function to test the number as follows: 2_If the…
A: The function toTest() ask user to enter a number which is then compared with the already initialised…
Q: A tic-tac-toe grid of size n is a grid composed of empty tiles bounded by solid lines. The grid is…
A: The following is the code with comments I tried to my best to comment as clear as possible.
Q: in java write a program to satisfy the a and b requirements: a). Write an operation class that can…
A: Introduction of Program: Java program gives three choices to the user, 1. Convert the temperature…
Q: Finish the Java program inputNewPlayerLocation: to input (x,y) coordinates from user (using…
A: Point is the built-in java class that is available to use in java.awt package The Point class…
Q: In python -Once upon a time in the Land of Apples, John had three apples, Mary had five apples,…
A: The description is as- Taking 3 variables juan, maria, adan and storing 3,5,6 apples respectively.…
Q: Design the Library and Book class so that the expected output is generated. #Write your code here…
A: Algorithm: Start Create a class Library with a class variable books which is a list and instance…
Q: Create a program which the final grade is calculated from an input like the image. So with use of…
A: According to the information given:- We have to calculate the average grade from where the final…
Q: USING TKinter Please create a Python program based on the game of WAR. The rules of the game are as…
A: WAR - game of cards War game of cards is a simple Card game in which each player flaps the cards.…
Q: tic-tac-toe grid of size n is a grid composed of empty tiles bounded by solid lines. The grid is…
A: In the following block I have pasted the code with comments. I request you to go through and run in…
Q: write a python program to Create a variable containing the DNA sequence: ACGCAGAATGCTTAGGACTAGTTAC…
A: Start Declare a variable dna and initialize value Replace T with U and store it as rna Print middle…
Q: Write a program that can be used by a small theater to sell tickets for performances. The theater’s…
A: Introduction: In this question, we have to write a program that asked for the prices of each seat of…
Q: Write a Python program that can convert a Fahrenheit temperature to Celsius, or vice versa. The…
A: Program code: filename: temps.py def c_to_f(tempCelsius): """ Function that converts…
Q: Write a program that will allow a student to compute for his equivalent semestral grade. • The…
A: The answer is given below.
Q: Implement the design of the Travel class in python so that the following output is produced: You…
A: Algorithm: Start Implement class Travel with a static variable count and class variables…
Q: Write a program to calculate total ordering cost. Jacob is a retailer for ice. Normally a bag of ice…
A: I give the code in python(because you have not mentioned any particular language) and also provide…
Q: Write a program that prompts the user for a U.S. dollar amount and then converts it to Japanese Yen,…
A: Please find the answer below :
Q: Modify the command-line argument example Hello.java, to handle a few command-line arguments. Ask the…
A: According to the Question below the Solution: Output:
Q: Can you write a new code in Java language with the values I sent you, just like this output? There…
A: Actually, c++ is a powerful general language. It is a high level language.
Q: THIS IS MEANT TO BE IN JAVA So far we've learned variables, branches, loops, and some array. The…
A: Here I have taken input from the user and stored it into a variable. Next, I have checked for the…
Q: Write a program that begins by reading a number of cents from the users as an integer (this is input…
A: In the Python 3 programming language, set all needed currency named variables to 0 to make floor…
Q: 3. A program that prints the power table for integers from 1 to 5. The table must include the…
A: public class Main{ public static void main(String[] args) { System.out.print("\t\t\t\t\tPower…
Q: Can you write a new code in Java language with the values I sent you, just like this output?…
A: Source code:- #include <bits/stdc++.h>using namespace std; int main(){ ifstream…
Q: Case 1: Input: 5.1, 5.1, 5.1, 5.1, 5.1. Expected Output: 26.
A: To program : The program should then add the five decimal numbers, convert the sum to the nearest…
Q: Write a python that calculates the position of a car moving in a 2D-plane given the list of…
A: To write the python program with the given description: Use a while loop, that will prompt the user…
Q: Develop a Java program using NetBeans , that initially display a menu to the user. The menu should…
A: Given: Develop a Java program using NetBeans , that initially display a menu to the user. The menu…
Q: Write a program in Java to generate the entire calendar for one year. The program must get two…
A: the program is given below:-
Q: Declare 4 integers variables as global, named: EvenNum, EvenSum, OddNum, OddSum and initialize them…
A: Use a loop to accept input and we follow loop as long as the input is non-negative
Q: java You must print the number declared double x; on the screen. With which of the following…
A: Format specifiers begin with a percent sign (%) and end with a converter. Since x is of type double,…
Q: write in JAVA LANGUAGE Create a program that will compute PRELIM, MID-TERM, PRE-FINAL, FINALS GRADES…
A: Task : Collect the 3 quiz marks in Prelim Midterm Pre-Finals Finals Output the list of grades…
Q: 1. Write a program that reads a Celsius degree in a double value from the console, then converts it…
A: Begin Take the celcius double value as input Compute the farhenheit Print value End
Q: Write a program that computes the fuel efficiency of a multi-leg journey. The program will first…
A: We need to write a Python program for given scenario.
Q: Write a program that creates a table for the user's choice of basic math operations (+, -, *, /, and…
A: def addition(): x = getsize() print("\n+ | ",end=' ') for i inrange(1,x+1): print(i,end=' ')…
Q: A python program that lets the user play the game of Rock, Paper, Scissors against the computer. The…
A: import random random.seed(300) def determineWinner(playerChoice, computerChoice): # Checking…
Q: For this assignment, write a program called Payday.java that will compute and print a person's…
A: Given:
Q: reate a java program that calculates the average test scores. Three employees in a company are ups…
A: Create a java program that calculates the average test scores. Three employees in a company are ups…
Q: I am stuck trying to create a program in PYTHON that calculates the coins needed to make change for…
A: Answer: I have done code and also I have attached code
Q: Write a Python program which computes win/loss record, average score and average point spread of a…
A: your_team=input("Enter the your team name: ")opponent_team=input("Enter the name of your opponent…
Q: Write an application in Python that allows a user to play the game Bulls and Cows against a…
A: Lets see the solution.
Q: Write a java program to find how much time required to execute a function which only have a print…
A: Algorithm: Start Implement a method display() with one print statement In the main method, create…
Q: Suppose you save $100 each month into a savings account with the annual interest rate 5%. So, the…
A: Lets see the solution.
Q: Create a java program that calculates the average test scores. Three employees in a company are ups…
A: Java Code: import java.io.BufferedWriter; import java.io.File; import java.io.FileWriter; import…
Q: Write a program that begins by reading a number of cents from the users as an integer (this is input…
A: Initialize all required currency named variable with 0 in python3 programming language so that the…
Q: For this assignment, write a program called Payday.java that will compute and print a person's…
A: Required: For this assignment, write a program called Payday.java that will compute and print a…
Q: Write program that can be used by a small theater to sell tickets for performances. The theater's…
A: Solution: Given, program that can be used by a small theater to sell tickets for performances.…
Q: You are asked to write a java program for an embassy to help with the visa process. Your program…
A: I give the code in Java along with output and code screenshot
Q: The Research team led by Bernadette Wolowitz at Cal-tech University has discovered a new Amoeba that…
A: Explanation: Include all the necessary header files. Declare the necessary variables. Take the user…
Q: Write a python program for a pig game that has two players that alternate turns rolling dice. In…
A:
On July 16, 1969, the Apollo 11 spacecraft launched from Earth. Write out a
You must import the time module to use its sleep function to make the countdown realistic:
import time
# This will make the computer wait for 1 second:
time.sleep(1)
The output must look like the following when you test your program:
60
59
58
…
3
2
1
LIFTOFF!!!
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 3 images
- In python The Nim game. Write a program for a two-player version of the game Nim: a human player will play against the computer. The game is simple: players take turns removing from 1 to 4 sticks from a pile of 13 sticks; the player who picks up the last stick wins the game. Here’s some pseudocode for the Nim game. Start by initializing some variables that will allow you to keep track of the state of the game: One variable should record how many sticks there are left in the pile; initially, this variable must be initialized to 13. There are two players in the game, who take turns. To remember who’s turn is next, use a variable with two states (= values). Say the variable is 1 if the human player is next, and it is 2, if the computer’s turn is next. Pick randomly the player who should start the game. Then, start the main loop of the game: the game should continue for as long as there still are sticks (at least one) to pick. In each repetition of the game loop, one player will play…Using Tkinter Library in Python: A particular talent competition has five judges, each of whom awards a score between 0 and 10 to each performer. Fractional scores, such as 8.3, are allowed. A performer’s final score is determined by dropping the highest and lowest score received, then averaging the three remaining scores. Write a program that uses this method to calculate a contestant’s score. The scores are entered in 5 entry boxes, your program will display a contestant’s score using a variable label on the window of your program (not a message box). Your program would show an error message (using a message box) if any score entered by the user is negative or greater than 10.Write a C# program that plays a guessing game with the user. Your program should select a random number between 1 and 50 and then let the user try to guess it. The program should continue asking the user for a number until he guesses correctly. (See below for some tips on random numbers). CHALLENGE #1: Modify your program so that it only allows the user 10 guesses, and then declares them to be an inadequate guesser if they haven’t gotten it correct. Your program should output the random number chosen. CHALLENGE #2: Modify your program so that after they guess a number (or get declared inadequate, if you do Challenge #1) that it asks them if they want to play again, and responds accordingly.
- Homework 1. Write a program to have the user guess a number stored in the program. If he guesses right, tell him so. If he guesses wrong also tell him. 2. Write a program with a user interface which allows the user to enter 2 integers. It should then give him the option of adding them, subtracting them, multiplying them or dividing them. It should then print the result. 3. Write a program with a user interface to allow a user to enter a number and to tell him whether the number is even or odd. Use the truncating property of int to do this. 4. Write a program with a user interface which allows the user to enter two numbers. Check if the first number is a multiple of the second number. If it is tell the user; if it isn't tell him also. 5. Write a program in which the user inputs a letter and you print it back If the letter is already t it cap again for him. 6. Same a previous question, only this time if it is capital, print it lowercase. 7. Let the user enter 3 numbers. Print the numbers…Write a C# program that plays a guessing game with the user. Your program should select a random number between 1 and 50 and then let the user try to guess it. The program should continue asking the user for a number until he guesses correctly. (See below for some tips on random numbers). CHALLENGE #1: Modify your program so that it only allows the user 10 guesses, and then declares them to be an inadequate guesser if they haven’t gotten it correct. Your program should output the random number chosen. CHALLENGE #2: Modify your program so that after they guess a number (or get declared inadequate, if you do Challenge #1) that it asks them if they want to play again, and responds accordingly. Some Random Number Generation HintsRandom rndNumber = new Random();Console.WriteLine(rndNumber.Next()); //random integerConsole.WriteLine(rndNumber.Next(101)); //random integer between 0 and 100Console.WriteLine(rndNumber.Next(10, 43)); //random integer between 10 and…JAVA Given an airplane’s acceleration a and take-off speed v, you can compute the minimum runway length needed for an airplane to take off using the following formula: length = v2 / 2 * a Write a program that prompts the user to enter v in meters/second (m/s) and the acceleration a in meters/second squared ( m/s2 ) , then displays the minimum runway length needed to take off. Here is a sample run: Enter speed and acceleration: 60 3.5 [enter] The minimum runway length for this airplane is 514.286
- You have been asked to write a program to play rock-paper-scissors. Your program will ask the user to input a number 0, 1, or 2 to denote rock, paper, and scissors respectively. Your program will then randomly generate a number 0, 1, or 2 to denote the computer’s hand. The rules for the game are: •A scissor can cut paper. •A rock can knock a scissor. •A piece of paper can wrap a rock. Let the game run continuously until either the user or the computer wins 3 times, displaying the outcome of each hand. At the end of the game, display a message indicating whether the user or the computer wins Helpful Hint: import random player2= random.randint(0, 2)write a program in python Write a program that will allow a student to enter their name and then ask them to solve 10 mathematical equations. The program should display two random numbers that are to be added, such as: 247 + 129 The program should allow the student to enter the answer. The program should then display whether their answer was right or wrong, and accumulate the right values. After the 10 questions are asked, calculate the average that was correct. Then display the student name, the number correct, and the average correct in both decimal and percentage format. In addition to any system functions you may use, you might consider the following functions: A function that allows the student to enter their name. A function that gets two random numbers, anywhere from 1 to 500. A function that displays the equation and asks the user to enter their answer. A function that checks to see if the answer is correct and accumulates the number correct. A function that calculates the…An instructor gives a series of exams during the semester in her math class. At the end of the semester she drops each student's lowest test score before averaging the scores. She has asked you to design a program that will read a student's test scores as input and calculate the average with the lowest score dropped. Here is the algorithm that you developed: Get the student's test scores. Calculate the total of the scores. Find the lowest score. Subtract the lowest score from the total. This gives the adjusted total. Divide the adjusted total by 1 less than the number of test scores. This is the adjusted average. Display the average. The test scores are in a text file named scores.txt and contains the following: Mickey, 71.0, 42.0, 83.0 Donald, 94.0, 73.0, 72.0, 81.0 Minnie, 95.0, 85.0, 45.0, 55.0, 65.0 A sample run is as follows: Enter a file containing floating point numbers: scores.txt Test scores for Mickey: ['71.0', '42.0', '83.0'] Removed the lowest score of 42.0 for Mickey The…
- A python program that lets the user play the game of Rock, Paper, Scissors against the computer. The program should work as follows: When the program begins, a random number in the range of 1 through 3 is generated. If the number is 1, then the computer has chosen rock. If the number is 2, then the computer has chosen paper. If the number is 3, then the computer has chosen scissors. (Don’t display the computer’s choice yet.) The user enters his or her choice of “rock,” “paper,” or “scissors” at the keyboard. The computer’s choice is displayed. A winner is selected according to the following rules: If one player chooses rock and the other player chooses scissors, then rock wins. (Rock smashes scissors.) If one player chooses scissors and the other player chooses paper, then scissors wins. (Scissors cuts paper.) If one player chooses paper and the other player chooses rock, then paper wins. (Paper wraps rock.) If both players make the same choice, the game must be played…A junior magician has picked a secret number. He has hidden it in a variable named secret_number. He wants everyone who run his program to play the Guess the secret number game, and guess what number he has picked for them. Those who don't guess the number will be stuck in an endless loop forever! Unfortunately, he does not know how to complete the code. Your task is to help the magician complete the code in the editor in such a way so that the code: will ask the user to enter an integer number; will use a while loop; will check whether the number entered by the user is the same as the number picked by the magician. If the number chosen by the user is different than the magician's secret number, the user should see the message "Ha ha! You're stuck in my loop!" and be prompted to enter a number again. If the number entered by the user matches the number picked by the magician, the number should be printed to the screen, and the magician should say the following words: "Well done,…Using python language, make a unit conversion program that computes and shows the three types of conversion (Ex. 12 inches = (1) foot/feet, (30.48) centimeters, (304.8) millimeters). You can only use the aforementioned measurements (length, weight, speed, or time).The unit conversion program allows the user to input a chosen conversion and repeats the program until the word "stop" is typed. A message is shown after converting the value.