Q: A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some…
A: A codon is a sequence of three nucleotides (a triplet) that encodes a specific amino acid or signals…
Q: A maintenance worker in a company performs a large part of his work outdoors, however, sometimes he…
A: The eye and facial protection that a maintenance worker needs to wear when working both inside and…
Q: List all the environmental impacts that occur during the "life span" of gasoline; that is, from…
A: Gasoline, also known as petrol, is a liquid fuel derived from crude oil that is used to power…
Q: Give three examples of female sexual selection for ornamentation in males and explain how preference…
A: Females choose partners based on particular qualities or behaviours that are regarded as…
Q: Which of the following is the best definition of generation time in a bacterium? the time it takes…
A: Bacterial growth refers to the increase in the number of bacterial cells in a population over time.…
Q: Answer the questions below to help you write your case summary. 2. Use the scroll bar on the right…
A: Kidney failure is also known as renal failure which can be diagnosed through a combination of…
Q: 1) The olfactory receptor neurons in frogs resemble those of mammals, in that they express olfactory…
A: Important for transduction of sensory signals Can discriminate wide variety of odorant Belongs to…
Q: Show the cross between a heterozygous purple flowered pea plant and a white flowered pea plant. What…
A: Alleles are different versions of the same gene that can exist in a population. Each individual…
Q: Based on the evidence in the diagram, which statement is true about fungi?
A: Fungi are eukaryotic, heterotrophic organisms which includes the yeast, molds , mushroom etc.
Q: 12. Shown below are three possible mechanisms for DNA replication. Identify which each kind is…
A: DNA replication is the process by which a cell makes an exact copy of its DNA before cell division.…
Q: The holes in Swiss cheese are caused by Air pumped into the cheese during the aging process. Carbon…
A: Swiss cheese is a type of cheese that is known for its distinctive appearance, with large holes or…
Q: Which of the following would NOT be characteristic of a single-source non-compromised STR profile?…
A: Short tandem repeat (STR) profiling is a technique used for DNA fingerprinting and identification.…
Q: Which of the cells in the hematopoietic stem cell niche MOST directly contributes to the maintenance…
A: Hematopoietic stem cells (HSCs) are responsible for generating all blood cell types throughout an…
Q: TATA TATAAT ATG STOP codon(s) AGGAGG CCUCCU ACCATGG CAAT GACA AAUAAA M = H Universal START codon SE…
A: Codon is a three nucleotide sequence which together firm a unit of genetic code in a DNA or RNA…
Q: Cajal bodies and speckles are associated with assembly and components of snurps. : a) True b) False
A: RNA (Ribonucleic acid) is a molecule that plays a crucial role in the expression of genetic…
Q: A common misconception about mutations is that they are always harmful. What mutation effects on an…
A: A mutation is a change that occurs in the DNA sequence of a gene or a chromosome. Mutations can be…
Q: Question #3: CRISPR has been used to cure an individual from sickle cell. Below is a Sanger…
A: Sickle cell anemia is a genetic disorder affecting the structure and function of hemoglobin, a…
Q: 1. (a) Define placebo (b) Suppose there is a new drug targeting a type of cancer and the clinical…
A: Clinical trials are research studies conducted with human volunteers to evaluate the safety and…
Q: Bile exits the gallbladder in the hepatic duct common bile duct cystic duct hepatopancreatic duct
A: A tiny organ beneath the liver called gallbladder is essential to the functioning of the digestive…
Q: what are the factors affecting yeast diversity in marine environment and factors affecting seaweed…
A: Areas, where the reconciliation is done to conserve biodiversity and its sustainable use, are called…
Q: Give one example of a segmented virus and describe how the structure of the virus influences its…
A: example of a segmented virus is the influenza virus which has 8 or 9 segments of RNA in its genome.…
Q: 6. Using the material covered in this unit, and your own research, outline and describe the impact…
A: Charles Darwin's theory of evolution, also known as Darwinism, proposed that all species of…
Q: a. Explain the meaning of mobile and immobile elements in relation to the development of deficiency…
A: Deficiency symptoms are the physical manifestations a plant makes when it is deficient in one or…
Q: Why does inbreeding lead to an increase in recessive deleterious traits (for example inbreeding…
A: Breeding is the process of mating selected individuals of a particular species with desirable traits…
Q: Station #l: Passive Transport 1. Passive transport = Examples) a. b. Station #2: Active Transport 2.…
A: Cell membranes separate the inside of the cell from its surrounding environment. Cell transport is…
Q: Choose 5 filter feeders including sponges and whale sharks, each from a distinct animal phyla or…
A: A filter feeder is an animal that obtains its food by filtering particles from water or air. This…
Q: Disadvantages of use of an oral contraceptive which contains only an estrogen the original…
A: Contraceptives are generally used to prevent unwanted pregnancy as well as to prevent the spread of…
Q: What is Favipravir(c5h4fn3o2) used for? What could be the predicted open structure of the palladium…
A: The antiviral drug favipiravir (C5H4FN3O2) is used to treat influenza and a few other viral…
Q: The lab provides you with 25 mg/ 100 mL of BAP stock solution. You only need 1 mg of BAP in 180 mL…
A: A substance used for growing and developing microorganisms, cells or tissues in a laboratory setting…
Q: Which of the following formulas are correct regarding productivity? (recall, GPP gross primary…
A: Gross primary productivity It is the total amount of carbon compounds produced by a plant in an…
Q: Centers of transcriptional repression that are usually associated with lamina or found around…
A: Barr bodies are transcriptionally repressed centers meaning that most genes on the inactivated X…
Q: What is one thing in our modern environment that we are better adapted to than in our…
A: In genetics fitness is a measure of a person's capacity for surviving and procreating in their…
Q: 1How are gases detected in liquid broth cultures?How are gases detected in agar slants
A: Culture media is a substance or mixture of substances used to support the growth of microorganisms…
Q: Provide an example of a passive immunity created artificially. How does the vaccinated person gain…
A: Artificial passive immunity is a form of immunization that involves the administration of pre-formed…
Q: A mutation in the coding region of a gene may alter the of the gene. protein-coding region may alter…
A: Mutations are changes in the DNA sequence of an organisms genome. DNA is the genetic material that…
Q: At time point A, the patient's IgG titer against antigen X is 1:6, the patient's IgM titer to the…
A: The immune system is a complex network of cells, tissues, and organs that work together to defend…
Q: en the following protein, which of the following uences of TEMPLATE strand DNA would code for it?…
A: The process of the formation of RNA strand with the help of the enzyme RNA polymerase according to…
Q: What makes a trait susceptible to reversals in a phylogeny (microbial diversity)?
A: The variety of microorganisms found in a certain environment such as soil, water, air, or living…
Q: what were some of the change over time that happen in whale science, identify the major discoveries…
A: The whale population define to the number of whales, which are big (larger) marine mammals belonging…
Q: raw a figure of oxygen consumption (L·min´¹) over time from resting to the start of exercise at…
A: When a person exercises his muscles work harder, and his body uses more oxygen and produces more…
Q: A researcher discovers a mutation in the promoter region of a gene that increases the rate of…
A: A mutation is a change in the genetic information (DNA sequence) of an organism. This change can…
Q: identify the slide botany
A: Structure of Leaf The leaf is a structure that functions as a receptacle for receiving the sunlight…
Q: DNA synthesis
A: DNA: It is deoxyribonucleic acid which is a double-stranded nucleic acid which contains genetic…
Q: Which is the correct answer. I don't see it in your response.
A: The propagation of nerve impulses from one neuron to the next neuron occur at the synapse. The axon…
Q: All of the following are characteristics of the active site of an enzyme EXCEPT? It has less water…
A: Enzymes are biological catalysts which are typically proteins that speed up chemical reactions in…
Q: Which of the following symbiotic mutualisms involves a fungus and an alga. Mark only one oval. A)…
A: Mutualism : Mutualism is a type of ecological relationship between two or more species in which both…
Q: . Write a 1 to 2--page essay explaining the side you have chosen and why. • Introduction paragraph.…
A: Introduction Climate change is a topic of significant concern in today's world. The Earth's climate…
Q: A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some…
A: Mutations are changes that occur in the DNA sequence of an organism. They can arise spontaneously…
Q: A tRNA that could “read” the 5’ GAA codon of glutamic acid would have the anticodon: Answer choices…
A: Transfer RNA (tRNA) is a type of RNA molecule that plays a crucial role in protein synthesis by…
Q: A. Find information from 1 of the 3 sizes that are below Small 1.finches 2. Parakeets Medium…
A: Restriction refers to a method of immobilizing a bird, such as a Cockatiel, to prevent it from…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 3 steps
- HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)5’- TTGACATGCG ATGTCGTAGG GATATATAAT CCACACAGTC GACAATTGAC ATCCCGGTCA CCTATAATCG TGAACACATA TAAGGAGTCT GACTATGGTA AGTAAATATG GTCATTAGTT ATGTGAACAG CCATTGGAGT CCACACTGAC TGAGATTAAG AGATGCCGAT AAAGTGGATA GCATTTTAAC TTGACAATGG ACGATCGATC GTAATTACCA ATGTGAATCG TAGTTGCGCA TTTCGGACGT -3’ a) Counting from the first nucleotide (A) of the Shine-Dalgarno consensus sequence, show the sequence of the first 20 nucleotides in the mRNA encoded by this piece of DNA (specify 5’ & 3’ ends). b) What is the sequence of protein X (specify the amino and carboxyl termini)? c)A mutation occurs in the original DNA strand for protein X such that the adenosine nucleotide at position +35 is deleted. What is the effect of this mutation? d) A mutation occurs such in the original DNA for protein X strand such that the adenosine nucleotide at position +48 is changed to a thymine. What is the effect of this mutation?1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate V
- 26 F Identify the image shown in the picture. CITLES T9201703 aitavia bns standzus omne ledet avode margsib ad: nf is Lari valab ni aidaxo babivong magsih art griau nont (d al gastos to sengug il blow weig 100 etantadija-emysne stb sew to rotse olup warb vies (5 563 is isbom ysx 8. Define, give an example of, and explain both Catabolism and Anabolism.Identify the image shown in the picture 88 te 林
- 16. Your Excel data graph for Serial Dilution lab:** 16a. Include a clear and labeled graph of DF (x axis) versus Absorbance (y axis). See box above for expectations and review video tutorial of this Excel work. Do not graph two of your data points: your blank or your Cuvette #1 (DF=1). 1 Q A Multiple Styles W S X 3 E D $ 4 To C R F % 5 I T V U ^ 6 G Y 7 H U 8 J BN S ( 9 K M X14 C fill the blank with correct answerB BE -70 Membrane potential (mv) +35 A) A. B) B. C) C. D) D. E) E. C) D) D. C. D 2 Figure 37.1 30) In Figure 37.1, the period in which voltage-gated potassium channels are open and hyperpolarization has yet to occur is at label 3 A) A B) B C) C D) D Time (milliseconds) 31) In Figure 37.1, the membrane's permeability to sodium ions is at its maximum at label A) A. B) B. 4 32) In Figure 37.1, at what point in the graph are sodium channels closed (or closing) and potassiu channels opened? 33) In Figure 37.1, the neuronal membrane is at its resting potential at label A) A. B) B. C) C. D) D. E) E
- First base U v A G 1.) 2.) 3.) U UUU UUC UUA UUG 1.) 2.) 3.) Phe Leu CUUT CUC CUA CUG GUUT GUC GUA GUG Leu AUU AUC lle AUA AUG start Met or Val Second base C A UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UGU Tyr Cys UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg Gly UCAG с UCAG А UCAG с А UCAC с G Provide the nine base sequence of the mRNA in triplet form. 1.) 2.) 3.). List the three tRNA anticodons in triplet form. Third base Use the codon map to determine the amino acids coded by the mRNA strand (please use only the abbreviations):What is the size for cut lane #5 to measure the Sac1? The T-vector size is 3kb, what is the size for the insert?What is the Heimlich maneuver used for?