MAKE CONNECTIONS Considering the chemical characteristics of the amino acidsvaline and glutamic acid (see Figure 5.14), propose a possible explanation for the dramaticeffect on protein function that occurs when valine is substituted for glutamic acid.

MAKE CONNECTIONS Considering the chemical characteristics of the amino acidsvaline and glutamic acid (see Figure 5.14), propose a possible explanation for the dramaticeffect on protein function that occurs when valine is substituted for glutamic acid.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter31: Completing The Protein Life Cycle: Folding, Processing, And Degradation

Section: Chapter Questions

Problem 3P: Understanding the Relevance of Chaperones in Protein Folding Protein molecules, like all molecules,...

See similar textbooks

Related questions

Q: Draw every step involved in the chemical synthesis of the dinucleotide (5')CG(3'). Show molecular…

A: The nucleic acid is a macromolecule that is found in all living organisms and the DNA is a class of…

Q: Distinguish the two methodologies used for getting a complete protein structure. Will the structural…

A: Proteins are essential for every cellular process occurring in a biological system as they control…

Q: Given: Cryo-EM structure of PCoV_GX spike glycoprotein 1. What can you tell me about the identity…

A: Viruses are non-cellular particles that need a host cell to survive. Viruses are not considered…

Q: 8. Predict the effect of each of the following environmental changes on the pKa of a glutamate side…

A: The proteins are made of twenty naturally occurring amino acids. Alpha carbon of amino acids consist…

Q: Using protein leptins' primary, secondary, and tertiary structure, explain your understanding on…

A: Major hormones are proteins or peptide hormones, which are mostly water soluble. Leptin is a…

Q: novel protein is described that functions best at pH 10.5, and contains a beta strand on one side.…

A: Proteins are unbranched polymers constructed from 22 standard α-amino acids. They have four levels…

Q: You have isolated a new protein called STICKY. You can predict from comparisons with other known…

A: Proteins are essential nutrients for the human body. They are one of the building blocks of body…

Q: ctabolism in the to particular experiment. It is known that potatocs practically do not contain…

A: There are various verities of food that we consume contain nutrients, fatty acids , carbohydrates ,…

Q: Illustrate the Analyze protein structure, and predict protein functionson the basis of identified…

A: Proteins are made up of amino acid chains. Protein domains are conserved polypeptide regions that…

Q: Chemistry Draw the mechanism for the serine protease catalyzed hydrolysis of a diglycine peptide.

A: Serine protease is considered as the class of the protease enzyme, which helps in the hydrolysis of…

Q: 5. Protein folding is largely influenced by the interaction of the R-groups (side chains) with the…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…

Q: You have isolated a new protein called STICKY. You can predict from comparisons with other known…

A: This motif is formed by two alpha helix connected by a loop. Dimeric transcription factors usually…

Q: Protein A interacts with biomolecule B and forms a complex AB, with a dissociation constant KD = 1…

A: Consider the following reaction: P + L ⇌k2k1 PL where P is the protein, L is the ligand and k1 and…

Q: 2. Draw a dipeptide with a trans linkage and a net charge of -1 at pH 7 a. Indicate which six atoms…

A: The peptides are composed of twenty standard amino acids that differ from each other in their…

Q: A group of researchers isolate 'Protein X' from the wall of a human stomach with the intent of…

A: The protein is an extremely complex substance which consist of amino acid residues jointed by…

Q: Which statements are true? Explain why or why not.1 Each strand in a β sheet is a helix with two…

A: As per our honor code, we are authorized to answer one question at a time, since you have not…

Q: 1. Name and draw the structures of standard amino acids that would likely form hydrogen bonds with…

A: Protein structures are stabilized by covalent and non-covalent bond. Covalent bond include peptide…

Q: Suppose you have a peptide composed of 4 amino acids bonded together: alanine, arginine, asparagine,…

A: Amino acids are the type of biomolecules that form polymers by combining through a peptide bond. The…

Q: SAQ Consider the structure (at physiological pH 74) of the following molecules and then answer the…

A: Amino acids are made up of a central carbon attached to a hydrogen atom, an alpha-amino group, an…

Q: ) By looking at the amino acid composition of the protein, we know it has 1 Tyr in it, but some how…

A: The problem based on beer Lambert law , On the basis of molar extension coefficient , path length,…

Q: Suggest an explanation for the observation that when proteins are chemically modified so that…

A: A polypeptide chain is made on cellular structures, called the ribosomes. This is done by a complex…

Q: Draw (using Haworth projections) the fragments of xylan and glu- comannan structure

A: Glucomannan is a mainly linear heteropolymer consisting of β-1,4-linked d-mannose and d-glucose.…

Q: 3. Which one of the protein secondary structures proposed by Corey and Pauling is stabilised by…

A: The protein is formed by the polymerization of amino acids. A peptide is formed due to the…

Q: What are the structural features of 7N7H (Viperin-like enzyme)? a) Must show 3D structure

A: An enzyme is a biological catalyst. it is usually protein. 'Viperin' is a member of the radical…

Q: you have isolated a new protein called STICKY. you can predict from comparisons with other known…

A: A new protein named "STICKY" is isolated, which possesses a specific region in its structure. These…

Q: 4. A hypothetical protein has a molar mass of 23,300 Da. Assume that the average molar mass of an…

A: Ans- a.) Molar mass of protein = 23,300 Da Average molar mass of amino acid = 120 Da # Therefore…

Q: Which feature of protein folding is NOT accurate?

A: Proteins perform a variety functions within organisms, including catalysing DNA…

Q: 2- The odorant-binding protein (OBP) was described in rat and cow as a lipocalin that binds odorants…

A: Abstract NGAL (neutrophil gelatinase-associated lipocalin) also known as lcn2 or siderochalin is…

Q: Identify a peptide bond, the N-terminus (amino-terminus) and C- terminus (carboxyl-terminus) of a…

A: Hi. Since you have asked multiple questions. We are answering the first two for you. Please…

Q: 2 A biomolecule has a K_d of 1.6mM. A mutated-version of the same biomoleucel was bound by ligan by…

A: Enzymatic catalysis begins with the creation of an enzyme-substrate complex. The enzyme first binds…

Q: Make an analysis of the electrophoresis data below. Comment on the purity, number of subunits, and…

A: Native gel electrophoresis is the process of separation without adding any denaturing agent like…

Q: Calculate the approximate MW of a protein with 341 amino acid residues and express it ing/mol and…

A: Given Values: Number of residues in the protein = 341 aa Average molecular weight of an amino acid =…

Q: Select correct properties of alpha-helices: O A. Small amino acids, glycine and alanine, are…

A: Alpha-helix is a secondary structure that is stabilized by the H-bond. Hydrogen bonds forms between…

Q: Chemistry A biomolecule has a K_d of 1.6mM. A mutated-version of the same biomoleucel was bound by…

A: [P] + [L] → [PL] Dissociation constant, Kd = [P] [L] / [PL] Dissociation constant (Kd) - is…

Q: missense mutation will influence the tertiary or quaternary structure of the protein (FGFR3). How…

A: Missense mutation A missense mutation specifically defines the kind of point mutation in which the…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified…

Q: 4. Write the Edman degradation technique used for the sequencing of proteins 5. A helix contains 308…

A: Edman degradation is the process of purifying protein by sequentially removing one residue at a time…

Q: ACTIVITY 7.1.2 Write the structural formula of dATP, DTTP, DCTP, dGTP, UTP, and give the complete…

A: Introduction: Deoxyribonucleic acid is made up of subunits called nucleotides. Each nucleotide…

Q: 9) Propose a synthetic sequence for the dipeptide A-D-G (single-letter codes) starting from the free…

A: Hi! Since you have posted a multipart question , we will solve the first 3 subparts for you…

Q: 5. Refer to Model 2 for information relevant to this question. A sample of the peptide Lys net…

A: Amino acids are organic compound having two functional group namely carboxyl and amino group. Some…

Q: Consider a protein with two surface-exposed histidine residues: HisA is a “typical” histidine…

A: Histidine is a basic residue having a amino group in its side chain and involved in the form of…

Q: 9. Shown below is a binding pocket for a protein with a ligand bound. The ligand interacts with a…

A: For an equilibrium interaction between a Protein 'P' and Ligand 'L' forming a Protein-Ligand…

Q: Anfinsen studied protein folding using RNaseA.

A: Proteins are highly sensitive to temperature, pH reducing and denaturing agents.

Q: Q:All of the following types of interactions co-operate in stabilising the tertiary structure of…

A: Protein is a substance consists of amino acids. Protein is present in all living organisms and is…

Q: WHAT IF? Where would you expect a polypeptideregion rich in the amino acids valine, leucine, and…

A: Polypeptide chains are made up of amino acids linked by peptide bonds. The amino acid side chains…

Q: 23. The following data describe the cleavage of peptide bonds in small peptides by the enzyme…

A: Introduction: Serine proteases are a large group of enzymes that cleaves the amide bond and…

Concept explainers

Nitrogen metabolism

Nitrogen metabolism is the synthesis, utilization or uptake, breakdown, and excretion of nitrogenous compounds in the body. The nitrogen metabolism encompasses nitrogen fixation, biosynthesis, and the breakdown of amino acids, purines, and pyrimidine. Since nitrogen-containing compounds are required for various life processes, nitrogen is an important element of life.

Question

MAKE CONNECTIONS Considering the chemical characteristics of the amino acids
valine and glutamic acid (see Figure 5.14), propose a possible explanation for the dramatic
effect on protein function that occurs when valine is substituted for glutamic acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step 5

Trending now

This is a popular solution!

Step by step

Solved in 5 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Understanding the Relevance of Chaperones in Protein Folding Protein molecules, like all molecules, can be characterized in terms of general properties such as size, shape, charge, solubility/hydrophobicity. Consider the influence of each of these general features on the likelihood of whether folding of a particular protein will require chaperone assistance or not. Be specific regarding just Hsp7O chaperones or Hsp7O chaperones and Hsp60 chaperonins.
Predict the direction of migration for the following amino acids in solutions of the specified pH. Write Isoelectric, if no migration occurs: Lys at pH=12 (pk values: 2.2; 9.2; 10.8) Glu at pH= 2.0 (pk values: 2.1; 9.5; 4.1) Leu at pH= 6.0 (pk vaues: 2.3; 9.7)
. Apamine is a small protein toxin present in the venom of the honeybee. It has the sequence CNCKAPETALCARRCQQH (a) If apamine does not react with iodoacetate (see Tools of Biochemistry 5B), then how many disulfide bonds are present? (b) If trypsin cleavage gave two peptides, then where is(are) the S-S bond(s)?
Need help The β chains of HbA and HbS were treated with trypsin, and the sequence of the N-terminal tryptic peptides are as given below. Do these peptides separate from each other in an electric field if the pH is 7.0? Explain in detail the reasoning behind your answer and include your calculations for the charge of each peptide in your answer. HbA: Val-His-Leu-Thr-Pro-Glu-Glu-Lys HbS: Val-His-Leu-Thr
A. Write the structure of the following peptide at pH 5.0 and calculate its net charge at this pH. Asp-His-Tyr-Arg-Lys-Leu-Thr-Gln. Based on the pKa value of the ionizable groups. B. A polypeptide consisting only of L-glutamate residues (poly-L-glutamate) may have a random coil or helical structure depending on pH. Explain this behavior by indicating at what pH values the helical structure will be favored.
Determine the sequence of the following heptapeptide: • Amino acid analysis of the heptapeptide revealed that the original peptide was composed of: R, V, Y, E, K, A and G. • Reaction of the heptapeptide with dansyl-Cl and acid hydrolysis gave dansyl-A. • Digestion of the heptapeptide with: • carboxypeptidase gave G as the first detectable amino acid. • trypsin gave free R, a dipeptide (A-K) and a tetrapeptide containing E, G, Y and V • digestion of the tetrapeptide above (derived from the trypsin digestion above) with chymotrypsin gave two dipeptides: V-Y and E-G. • pepsin gave a tetrapeptide and a tripeptide (Y-E-G).
Patients suffering from sickle cell anemia have a mutation in the gene that codes for one of the hemoglobin chains, in which a single glutamate is replaced by a valine. Propose an explanation for why this substitution has such a striking effect on protein structure and function with explanation. Suggest two other amino acids that would be less likely to cause such serious impairment of hemoglobin function if each was substituted for glutamate. Briefly explain your answer.
i. A schematic structure of the subunit of hemerythrin (an oxygen-binding protein from invertebrate animals) is shown to the right. (a) It has been found that in some of the a-helical regions of hemerythrin, about every third or fourth amino acid residue is a hydrophobic one. Suggest a structural reason for this finding. (b) What would be the effect of a mutation that placed a proline residue at point A in the structure?
Consider a protein in which a negatively charged glutamic acid side chain (pKa=4.2)(pKa=4.2) makes a salt bridge (ion-ion interaction) with a positively charged histidine side chain (pKa=6.5)(pKa=6.5). Do only part B.
For the oligopeptide below Gly-Asp-Ser-Cys-His pKa of terminal amino group: 8.0 pKa of Asp: 4.1 pka of Cys: 8.3 pka of His: 6.0 pKa of carboxylate-terminus: 3.1 a) Draw its chemical structure at pH = 5.0. (Draw it on a piece of paper, take a picture, and then attach it here.) b) What is the pka of this oligopeptide? Show your work.
Consider a protein with two surface-exposed histidine residues: HisA is a “typical” histidine residue with a pKa = 6.2 HisB is involved in a stabilizing interaction (His-NH+ ..... -O2C-Glu) with a neighboring glutamic acid residue. For HisB, the Gibbs free energy of deprotonation at pH = 7.0 and T = 293K is ΔG'o = +15 kj mol-1. If you had a solution, at pH = 7.0 and T = 293K, containing this protein: a) What fraction of HisA residues are protonated? b) What fraction of HisB residues are protonated? c) What is the pKa of HisB?
-. A schematic structure of the subunit of hemerythrin (an oxygen- binding protein from invertebrate animals) is shown below. (a) It has been found that in some of the a-helical regions of hemerythrin, about every third or fourth amino acid residue is a hydrophobic one. Suggest a structural reason for this finding. (b) What would be the effect of a mutation that placed a proline residue at point A in the structure? A Fe