Answered: Make 2 mL of 50 fold dilution of DNA…

Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer. DNA: 400 uL Sodium phosphate buffer, pH 6.9, 10mL - Calclate amount of DNA & buffer need to make dilution

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Structure, localization and biological significance of glycogen.

A: Introduction Cell needs energy for various metabolic processes. Glucose breaks into pyruvate and…

Q: 14. Consider the molecules below and the answer questions that follow. CH-0-8-R₁ HC-0-C-R₂ 0-4-0-0₂…

A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…

Q: In order to break the carbon-carbon bond of Acetyl-CoA in a way that does not harm the cell, citrate…

A: Glycolysis is the metabolic pathway by which 6-carbon glucose is converted into 3-carbon pyruvate in…

Q: 2. What is the terms used to describe what is happening to the members of the electron transport…

A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…

Q: Explain how gluconeogenesis ang glucogenolysis are regulated to maintain blood glucose levels during…

A: Gluconeogenesis is the process of transformation of non-carbohydrate substrates ( lactate, amino…

Q: Provide the name of the following nitrogen-containing heterocyclic base. Z-I N A NH TU

A: The four major classes of biological macromolecules are nucleic acids, proteins, lipids and…

Q: Yield of ATP in complete oxidation of stearic acid including payback of transport costs using…

A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…

Q: Show below is a polypeptide comprised of 3 α-helices and 5 β-sheets joined by randomcoil.…

A: Tertiary structure of a protein is the 3-D structure of the polypeptide after it has undergone…

Q: Explain biochemical pathways mechanistically. Describe the β-oxidation pathway. Describe the…

A: Lipids are stored in the form of triacylglycerols in the body. When there are no carbohydrates in…

Q: Question 6 In membranes, one of the most common targets of reactive oxygen species are saturated…

A: Fatty acids are carboxylic acids with a hydrocarbon chain. Saturated fatty acids are fatty acids…

Q: Glycolysis is the process by which energy is harvested from glucose by living things. Several of the…

A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…

Q: Elongation of fatty acids chains beyond 16 carbons takes place: on the membrane of the endoplasmic…

A: Acetyl CoA from glucose oxidation or other anaplerotic reactions is produced in mitochondria and…

Q: true/false: The carbon skeleton produced by catabolism of asparagine enters glycolysis as…

A: Anaplerotic reactions are reactions that produce intermediates of TCA cycles. Conversion of…

Q: How many NET molecules of ATP are produced during the Embden-Meyerhof pathway of glycolysis for…

A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…

Q: Metabolism is best defined as a collection of Ocellular processes that activate cell division.…

A: Biochemistry is an attempt at explaining the living cell in chemical terms. A living cell is the…

Q: What percentage of molecules of peptide GGGG has no ionized groups (e.g. has BOTH protonated…

A: Amino acids: An amino acid can function as both an acid and a base because of its structural…

Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…

A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…

Q: Secondary messengers and their role in the mechanisms of hormonal influence on target cells:…

A: Phosphatidylinositol (PtdIns) is a lipid molecule composed of an inositol ring and two fatty acid…

Q: 1. Compute the concentration of the standard solutions by completing Table B.1. Report your answers…

A: Bradford assay is a method to estimate the protein concentration in the given sample. It is based on…

Q: Please describe four different modes of the regulation of the pentose phosphate pathway.

A: Introduction:- The Question is all about the pathway of pentose phosphate cycle that synthesis via…

Q: Compare and contrast biochemical pathways. Describe the chemistry of the last three steps of the…

A: The citric acid cycle involves the oxidation of acetyl-CoA into CO2 and H2O. The beta-oxidation is…

Q: 2. Draw the structure of the fatty acid, 16:247,10, as it occurs at pH 7. Make sure double bonds…

A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…

Q: Draw the structures of reactants and products in the transamination in which glutamate and pyruvate…

A: In a transamination reaction, an amino group is transferred from a donor substrate to an acceptor…

Q: Briefly and in simple terms, describe the glycoside bond connecting two monosaccharides in a di- or…

A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…

Q: Assume that you are conducting a chain-addition polymerization using 5.47 grams of monomer (MW=…

A: The number of moles is given by the ratio of the given mass in grams to the molar mass(MW) No. of…

Q: a) You evaluate the lipoxygenase inhibition by different concentrations of octyl protocathechuate.…

A: Inhibitors are the substances that bind to enzymes to regulate their activity . There are…

Q: Determine the direction that each of the reactions will progress. Assume that the reactants and…

A: Since conditions inside the cell are different than standard temperature and pressure, biochemists…

Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…

A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets. The alpha…

Q: I now know the structure difference between myoglobin and hemoglobin , however which exctaly…

A: Myoglobin is a monomeric globular protein of 154 amino acids residues with an oxygen binding site.…

Q: BIOC 384 Structure and Function of Simple Sugars Q9.1: NutraSweet (aspartame) is not a carbohydrate…

A: Carbohydrates are organic molecules that are composed of carbon, hydrogen, and oxygen. They are…

Q: Identify the type of base and sugar group present in each nucleotide or nucleoside. HO. H₂C -CH₂ ОН…

A: A nucleotide consists of a base, a molecule of sugar and one of phosphoric acid. The sugar can be…

Q: d. What type of inhibition is exhibited against NAD* as a cofactor? Describe what is going on in…

A: There are three types of inhibitors-competitive, non-competitive and uncompetitive. In competitive…

Q: calculate the [PNP] in μM for each of these samples. For Table 2: Calculate the volumes of the 100…

A: 0.5mM =0.5 ×10-3 moles literi.e. 1 liter have 0.5 ×10-3 molesSo, 106 μL have 0.5 ×10-3 molesSo, 1…

Q: One of the molecules listed below is effective in reducing O2 affinity of human Hb in the absence of…

A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…

Q: Choose the best answers for each missing word from the list below. ____ regulated by ATP, Aspartate…

A: Enzymes are proteins found in the cell, these are bio catalysts that speed up the reaction without…

Q: Biochemistry Plz answer these 2 question 1. How to differentiate between beta-amylase from alpha…

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: v (micromol/sec) 120 100 80 60 40 20 0 <--X ...... Y 20 40 [A] (micromolar) 60 Enzyme X must have 2…

A: Assuming the enzyme follows Michaelis Mentos's enzyme kinetics. Km or Kd value is the substrate…

Q: 1. The lactose operon is controlled by both lactose and glucose. Fill in the following table to…

A: The lactose operon is a catabolic operon in Ecoli that encodes proteins that are necessary for the…

Q: Identify the enzyme. catalyzes REDOX reactions catalyzes structural rearrangement of molecules…

A: Enzymes are biocatalysts which increase the rate of biochemical reactions. Enzymes are classified…

Q: Phosphorylases and phosphatases catalyze the same reaction, the removal of a phosphate group. True…

A: Enzymes are usually protein molecules which catalyzes several biochemical reactions by decreasing…

Q: In 1971, Dr. Akira Endo, working at the Sankyo company in Tokyo speculated that fungi not only…

A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…

Q: Explain the regulation of biochemical pathways. Describe the regulation of β-oxidation. Describe the…

A: Beta oxidation is the catabolic pathway of degradation of fatty acids to release energy. Urea cycle…

Q: Experiment: Lipids Qualitative Tests Test Performed: Translucent Test Procedure 1. Fold your…

A: Lipids are a chemically diverse group of biomolecules with two common characteristics: low…

Q: The patient has mechanical jaundice. Will it affect the absorption of fat-soluble vitamins? There…

A: To live a healthy and active life, humans need a variety of nutrients. Good nutrition, or the…

Q: In the following structure, the carbon labeled [Select] carbon, the carbon labeled [Select] is…

A: Monosaccharides are the simplest units of sugars. All monosaccharides are either aldoses or ketoses.…

Q: Why do aminoacyl-tRNA synthetases need ATP? to prevent the 2'OH from being aminoacylated O to…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: Discuss how each denatures protein.

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Answer the Questions below: 1. Based on the experiment above, what is the means of detecting the…

A: Lipids are hydrophobic compounds that are usually made up of an alcohol backbone and a long chain…

Q: 1. Describe the role of Cys in the catalytic mechanism shown. 2. Describe/predict the…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: The inhibitor X prevents coenzyme Q (Q) from participating in electron transfer in the electron…

A: Electron transport chain is a chain of electron carriers present in the inner mitochondrial…

Question

Make 2 mL of 50 fold dilution of DNA solution and sodium phosphate buffer.

DNA: 400 uL

Sodium phosphate buffer, pH 6.9, 10mL

- Calclate amount of DNA & buffer need to make dilution

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Solution

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

An extraction Buffer, EB(200 mM Trish-HCL(Ph 8), 250 mM NaCl, 25 mM EDTA, 0.5% SDS) is used for DNA extraction from cells. Use their stock solutions to prepare their respective working concentrations for the given working volume of EB. Stock Solutions are: 1M Tris-HCL(pH~8) 0.5M EDTA 0.8M NaCl 10% SDS Show final calculaed values in the table given below. Component 1L EB 500 ml EB 250ml EB 100ml EB 200mM Tris-Hcl 250mM NaCl 25mM EDTA 0.5% SDS dH2O
If the absorbance at540nm of a biuret and protein solution containing 0.25mg/ml of protein .24 the absorbance of a biuret and protein and dna solution containing.25mg/ml of protein and 0.5mg/ml dna should be note the total volume is the same in both solutions 0.24 0.72 0.48 not enough infor
Quantity of total DNA in a 5ul sample: Absorbance at 260nm 0.002 and at 280nm = 0.0011
In SDS PAGE the resolving gel : is 4%(w/v) acrylamide,PH )6.8 is 6-20% (w/v) acrylamide is 4%(w/v) acrylamide
You make 100 ml of a stock solution for mounting sections, that contains 0.5g gelatin. You take 10 ml of this stock solution and add it to 990 ml 0.1 X phosphate buffered saline. The concentration of gelatin in this diluted solution is: 0.5% 0.05% 0.005% 0.0005% 0.00005%
Large proteins travel/migrate faster in both gel filtration chromatography and SDS- PAGE. O True O False
In SDS page, the ________ proteins will move through the gel fastest and first, and in size exclusion chromatography, the _________ proteins will elute from the column first. smallest; largest largest; largest largest; smallest smallest; smallest The volume of the beads is included in (Select all that applies) VT Vo Vi VS VL
The A280 of a protein sample loaded onto a gel was determined to be 0.767 (1.00 cm path length, after subtracting the blank). The total volume of this sample was 428 µL. 19.0 µL of this protein sample was mixed with 19.0 µL of 2X laemalli sample buffer and then 12.0 µL of the entire sample was loaded into the gel and electrophoresed. Calculate the amount of protein that was loaded into the gel (in µg).
You have been given a stock solution of dye that has a 10X concentration. You wish to make 750ul of a 1X dilution of this dye. Give the volume of 10X dye that you will use (in ul)
There are two proteins in a pH 7 buffer, what you know is: one has a lot of Asp and Glu, the other one has a lot of Lys, Arg and His. Below which approach will get the two proteins separated? gel filtration chromatography ultracentrifugation salting out ion exchange chromatography affinity chromatography
The SDS-PAGE protocol requires 0.5L of running buffer for the gel apparatus. The stock running buffer comes as a 20x concentrate. How should you prepare your running buffer? 50ml 20x stock + 450ml deionized water 450ml 20x stock + 50ml deionized water O 250ml 20x stock + 250ml deionized water 25ml 20x stock + 500ml deionized water 25ml 20x stock + 475ml deionized water 2ml 20x stock + 500ml deionized water O 100ml 20x stock + 400ml deionized water
The concentration of a DNA sample is 40 nano grams per milliliter how many nanoliters will be needed to obtain 0.5 nano grams of DNA