Lipoproteins like LDL and HDL transport lipids and proteins through the blood stream. Receptors on cells can bind to the lipoproteins and remove them fr the blood how does a cell take in a lipoprotein?
Q: Which of these options is NOT an example of a hypothesis that supports the occurrence of ecological…
A: The manner in which the way of means of in which new species turn out to be an end result of…
Q: The proteasome contains enzymes that cleave _________ bonds. Select one: a. peptide b. hydrogen…
A: The proteasome is a highly sophisticated protease complex designed to hydrolyze client proteins in a…
Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…
A: The plasma membrane is permeable only to certain molecules. This means that the membrane allows some…
Q: what are the structural features of the protein 6VJI? primary , secondary What are two features of…
A: Amino acids are the building blocks of proteins as numerous amino acids joined to one another…
Q: QUESTION7 Tine has type O blood and her sister Rose hes type All blood. What are the blood genotypes…
A: Introduction There are four different types of blood groups are found in human. Blood group A, B, AB…
Q: A = all of the dominant alleles for a particular trait in a specific population; a = all of the…
A: Given, A - dominant alleles a - recesssive alleles A - p and a - q Hardy Weinberg Equation is p + q…
Q: This is a molarity problem that I cannot figure out. If you could please help me understand the…
A: To create a solution with a lower concentration, a specific volume of the stock solution is mixed…
Q: Estimate the chronic daily intake of 1,1,1-trichloroethane from exposure to a city water supply that…
A:
Q: Place sequences a, b and c into the correct order based on start and stop codons. Sequence A…
A: Introduction Codons are units of genomic information made up of three nucleotides (trinucleotides)…
Q: Which answer lists activities in the order of more to less active? a. Running - sleeping - standing…
A: Exercise has several advantages. Positive health outcomes, improved attitude, and even improved…
Q: The anterior pituitary releases tropic hormones. The role of these hormones is ... to receive…
A: Tropic hormones are hormones that have other endocrine glands as their target. Most tropic hormones…
Q: Which of the following statements about convergent evolution is true? (a) It demonstrates how…
A: Evolution means an organism is keep evolving or bettering itself during the course of time. The gene…
Q: What is the function of gRNA in CRISPR-Cas technologies?It cuts DNA at a targeted sequence and…
A: Introduction There are two types of nucleic acids present in our cell, DNA and RNA. DNA acts as a…
Q: 1. Why do you need to keep your sample on ice during the sonication steps?
A: According to the answering guidelines I'm going to answer 1st question only. Please post the 2nd…
Q: We have 10 mL of cells to treat with Hydrogen Peroxide (H2O2), such that the final concentration of…
A: A stock solution refers to the concentrated form of chemical reagents which is diluted each time…
Q: Please answer fast What you chose to eat, when you chose to eat, and how much you chose to eat is a…
A: Eating is the process of breakdown and chewing of food. Eating is necessary for providing energy to…
Q: Which of the following would be the least desirable model species to learn how proteasomes govern…
A: Model species:- model organisms or species are those which can be easily handled and breed well in…
Q: During gestation, female rats were treated with oestrogen. What effect will this have on their…
A: According to the classic view of sexual differentiation, the differentiation of sex occurs in the…
Q: There are two ways in which rearrangement of domain- encoding gene segments can result in novel…
A: Introduction Prokaryotes: These are the organisms which have characteristic nucleoid rather than…
Q: What is the purpose of each reagent in gram-staining? Primary stain Mordant Decolorizing agent…
A: Christian Gram devised this approach to discriminate between two kinds of bacteria based on their…
Q: An explanation of the testosterone hormone structure (the functional groups and everything) - How…
A: Testosterone is produced by the interstitial cells of Leydig in testes in men. After secretion by…
Q: In a particular animal, coat color is under the control of two interacting genes. Each gene has a…
A: Introduction:- Genotype is defined as the genetic constitution of an individual organism that…
Q: When digested, fats are broken down into: a. fatty acids b. amino acids c. simple sugars
A: Introduction : Digestion is one of the main life process present in all living organisms. This…
Q: The polysaccharides are starch, glycogen, and cellulose. In the chart below, I put an 'X' under each…
A: Carbohydrates are composed of carbon, hydrogen and oxygen. The most simple carbohydrate is the…
Q: 4. You develop the covalently-acting irreversible kinase inhibitor ibrutinib shown on the left that…
A: Ibrutinib is a burton's tyrosine kinase (BTK) inhibitor authorized for the remedy of a couple of…
Q: Behavioral genetics is, by definition, a study of _________________
A: Please always mention the required parts in case of multiple ones. Thank you! Genes are the…
Q: What is the main difference between allopatric and sympatric speciation?
A: Speciation is a process in which origin of new species takes place in a population depending on a…
Q: Your entire genome is about 6.4 billion basepairs long. If 41% of the human genome is either…
A: Genome Genome is the heritable entity of organism which can transfer from parents to their…
Q: Write a note on fat soluble vitamins
A: Introduction A vitamin is an organic substance that is required in trace levels for good nutrition…
Q: A. Let us see if you can help Draky, who traveled from home to his work using bicycle, but has been…
A: Introduction An individual's blood is categorised according to their blood type based on the…
Q: Explain the steps in vesicle docking and fusion • What proteins are involved? What are their…
A: The science of cell structure and functioning is known as cell biology, and it is based on the idea…
Q: Consider the reaction: Ketoglomerate + NAD --> ketocitrate + NADH In the reaction to the left,…
A: Cellular respiration is a phenomenon in which glucose is used up and energy is liberated. It…
Q: Fats can be dispersed into small droplets by: a. Emulsification b. Digestion c. Goblet cells d.…
A: Fats, along with carbohydrates and proteins, are one of the three major macronutrient groups in the…
Q: Question 15 of 17 Fill in the blanks: is the wavelength in nanometer used in spectrophotometric…
A: protein estimation is the process of quantifying the protein content of a sample. The protein…
Q: Use this data, and sketch a graph by hand that would best fit the data. (think which type of graph…
A: Comb jelly fish Comb jellyfish is a marine invertebrate organisms belong to phylum ctenophora.
Q: Which of the following helped to lay the groundwork for understanding the record of historical…
A: The Earth was created by deposition from the solar nebula approximately 4.54 billion years ago,…
Q: What account for the reduction of levels of soluble carbohydrate and nitrogen of vegetation and…
A: As cattle production rises in America, Africa, and Asia1, grassland lands are becoming more crucial…
Q: Clarify why evolution occurs only in populations, not in individuals.
A: Evolution is the gradual change in the inherited traits of biological populations over many…
Q: The is morphological difference between bipolar neurons and unipolar neurons and that determines how…
A: As you are reading this book, think about the organs that are functioning within you right now! Your…
Q: Define and give an example of coevolution.
A: Evolution is the process of change in heritable traits of biological organisms over successive…
Q: 5. Ratios of the bases present in different samples of nucleic acid yielded the following results:…
A: Chargaff's rule states that in a double-stranded DNA or RNA, purines = pyrimidines.
Q: Proteins trafficked to the golgi arrive ____. In the chloroplast, proteins are trafficked in a _____…
A: Protein trafficking is the transport of proteins to the correct subcellular compartment. Proteins…
Q: Developing morbid obesity seems to require that individuals have a biological predisposition to gain…
A: Obesity can be transferred by gene from one generation to another generation. There have such genes…
Q: A gene present on both the X and Y chromosome in homo sapians is called ANT 3. There is a mutant…
A: Inheritance is the process of transmission of the genes from parent to offspring. It is the passing…
Q: A prokaryotic cell _______ contain lysosomes. A prokaryotic cell _______ contain golgi. Select one:…
A: Prokaryotic cell The cell is the fundamental , structural and functional unit of living organisms.…
Q: You accidentally used safranin as the primary stain and malachite green as the counter stain during…
A: Note: Since you have posted multiple questions so we will be solving the first one for you. As per…
Q: Should similarities in the DNA sequences of genes be considered evolutionary homology? Explain.
A: According to their shared evolutionary parent, distinct species of animals with similar structure,…
Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU
A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…
Q: substance that do not dissolve well in water are a. hydrophobic b. hydrophilic c.isotonic…
A: Introduction :- An substance that is attracted to water molecules and has a propensity to dissolve…
Q: Why are the similarities among organisms during early development evidence for evolution? Give an…
A: Evolution is the gradual change in the inherited traits of natural populations over many…
5. Please answer
Step by step
Solved in 3 steps
- T cells are often discussed in conjunction with the disease AIDS, in which a virus destroys these cells. How do T cells work to combat disease?Which of the following functions is morecharacteristic of carbohydrates than of proteins?a. contractionb. energy storagec. catalyzing reactionsd. immune defensee. intercellular communicationSuppose you were browsing in a health-foodstore and saw a product advertised: “Put anend to heart disease. This herbal medicinewill rid your body of cholesterol!” Wouldyou buy it? Why or why not? If the productwere as effective as claimed, what are someother effects it would produce?
- How do lipoproteins transport water-insoluble lipid molecules in the bloodstream?What is the major function of cholesterol esters? O Make cholesterol more hydrophobic so they can be sequestered in the core of a lipoprotein particle Add rigidity to biological membranes O Cleave triglycerides into free fatty acids O Guide lipoprotein particles back to the liver for breakdownLeptin inhibits eating and is secreted in amounts in direct proportion to body fat. Moreover, obese people have normal amounts of leptin and leptin receptor. Why, then, do people become obese?
- How does the serum cholesterol level control both cholesterol synthesis in the liver and LDL uptake? When serum cholesterol concentration is low, the synthesis of cholesterol in the liver is inhibited, and the synthesis of cell receptors is increased. Serum cholesterol level controls the formation of cholesterol in the liver by regulating proteins that synthesize cholesterol. O When serum cholesterol concentration is high, the synthesis of cholesterol in the liver is inhibited, and the synthesis of cell receptors is increased. Serum cholesterol level controls the formation of cholesterol in the liver by regulating enzymes that synthesize cholesterol. When serum cholesterol concentration is high, the synthesis of cholesterol in the liver is inhibited, and the synthesis of cell receptors is decreased. Serum cholesterol level controls the formation of cholesterol in the liver by regulating proteins that synthesize cholesterol. When serum cholesterol concentration is high, the synthesis of…Fructose and glucose are both monosaccharides, but the body metabolizesthese sugars differently. For example, glucose stimulates insulin releasefrom the pancreas (see section 28.4); fructose does not. Moreover, insulinstimulates leptin release. Finally, fructose is more likely than glucose tobe converted to fat. Use this information to propose an explanation for thecorrelation between the skyrocketing consumption of high fructose cornsyrup since 1970 and the rise in obesity during the same period.What is the role of each of the following lipoproteins in the transport of lipids? -VLDL -HDL -LDL
- Our stomachs secrete hydrochloric acid. Knowing the function of antacids, what do you think causes most “upset stomachs”?Today, due to the pandemic most people stay at home and most of them gain weight. Many weight loss products and drinks are introduced in the market which contains Carnitine: A fat mover. Explain the mechanism of action ofcarnitine in losing weight?When William H. was helping victims after a devastating earthquake in a region not prepared to swiftly set up adequate temporary shelter, he developed severe diarrhea. He was diagnosed as having cholera, a disease transmitted through unsanitary water supplies contaminated by fecal material from infected indiv iduals. The toxin produced by cholera bacteria causes Cl- channels in the lurninal membranes of the intestinal cells to stay open, thereby increasing the secretion of Cl- from the cells into the intestinal tract lumen. By what mechanisms would Na+ and water be secreted into the lumen in conjunction with Cl- secretion? How does this secretory response account for the severe diarrhea that is characteristic of cholera?