Lactose intolerant individuals do not produce the enzyme lactase. Studies show that the gene that encodes lactase is not transcribed. This gene is most likely associated with nucleosomes that are ______________ which can be caused by histone Uncondensed; acetylation Uncondensed; deacetylation Condensed; acetylation Condensed; deacetylation Uncondensed; methylation

Lactose intolerant individuals do not produce the enzyme lactase. Studies show that the gene that encodes lactase is not transcribed. This gene is most likely associated with nucleosomes that are ______________ which can be caused by histone Uncondensed; acetylation Uncondensed; deacetylation Condensed; acetylation Condensed; deacetylation Uncondensed; methylation

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

Like Hurler syndrome, Fabry disease involves an abnormal accumulationof substances within lysosomes. However, the lysosomesof individuals with Fabry disease show an abnormal accumulationof lipids. The defective enzyme is α-galactosidase A, which is alysosomal enzyme that functions in lipid metabolism. The enzymaticdefect causes cell damage, especially to the kidneys, heart,and eyes. The gene that encodes α-galactosidase A is found on theX chromosome. Let’s suppose a phenotypically unaffected coupleproduces two sons with Fabry disease and one phenotypicallyunaffected daughter. What is the probability that the daughter willhave an affected son?
The activity of ________ will result in an increasedpositive charge on the histone. Question 24 options: Histone acetyltransferase Histone deacetylase Histone methyltransferase Maintenance methylase Histone demethylase
Fill up the blank __________s are blood diseases caused by mutationsthat eliminate or reduce the production of globinpolypeptides from one of the clusters but not the other.These mutations can include deletions of specific genesor the LCR in either cluster.
Epigenetic changes in gene regulation are caused by ________. missing nucleotides or chromosomes missing nucleotides or chromosomes mutations of the nucleotide sequence mutations of the nucleotide sequence modifications to histones and the DNA, but not the nucleotide sequence itself
Enzymes that acetylate the ε-amino group of lysine in the histone tails are called ____ and are involved in initial events in transcriptional activation. histone methyltransferases histone acetyltransferases histone methylases histone deacetylases
The retinoblastoma tumor suppressor gene Rb (RB1) codes forthe retinoblastoma protein (pRB). pRB prevents the progression of the cell cycle through G1 if DNA has been damaged. Itdoes so in part because it binds a transcription-activatingdimer referred to as E2F-DP. The pRB-E2F/DP complex recruits a histone deacetylase to chromatin. Explain.
You are studying the M-cyclin. You treat mitotic cells with an inhibitor of the proteasome and find that M-cyclin is no longer degraded and that this prolongs mitosis. You also find that in the presence of the inhibitor, M-cyclin is now running slower/larger in a Western than you have previously observed. In 1-2 sentences, explain why this might be happening. Edit View Insert Format Tools Table 12pt Paragraph B IU Αν S A C I AT²✓ #tv A MacBook Air X : G
Stimulation of map kinase can help regulate cell division and cell mass. the following effects of map kinase activation explains an increase in cell mass. Phosphorylation of RSK (kinase and the subsequent phosphorylation of S6 ribosomal subunit. Phosphorylation of myosin light chain Phosphorylation of glyceraldehyde dehydrogenase phosphorylation of histone H1 none of these
Like Hurler syndrome, Fabry disease involves an abnormal accumulationof substances within lysosomes. However, the lysosomes of individuals with Fabry disease show an abnormal accumulation of lipids. The defective enzyme is α-galactosidase A, which is a lysosomal enzyme that functions in lipid metabolism. The defect causes cell damage, especially to the kidneys, heart, and eyes. The gene that encodes α-galactosidase A is found on the X chromosome. Let’s suppose a phenotypically unaffected couple producestwo sons with Fabry disease and one phenotypically unaffecteddaughter. What is the probability that the daughter will have anaffected son?
If lactose is present in a cell with the following genotype, will functional Beta – galactosidase and/or permease be made? LacIs, LacP+, LacOc, LacZ+, LacY- / LacI+, LacP+, LacO+, LacZ-, LacY+ Group of answer choices Both genes will make functional protein. Only Beta – galactosidase will be functional. Only permease will be functional. No functional proteins will be made.
A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?
Ultraviolet light causes thymine dimers to form in DNA. Some individuals are genetically incapable of repairing these dimers at "normal" rates. Such individuals are likely to suffer from Oxeroderma pigmentosum phenylketonuria muscular dystrophy Severe Combined Immunodeficiency (SCID) pancreatic cancer