kle cell hemoglobin DNA ÇACGTAGA CTGAGG ACA ckle cell hemoglobin MRNA ckle cell hemoglobin AA sequence ValoHis ku throproo Gill What type of mutation is this? Please explain why.
Q: Cystic hibros Ife-threatering disease that causes thick, stcky mucus to buid up in areas of the…
A: DNA is the genetic material in living organisms that is transcribed into mRNA. This mRNA is used for…
Q: The second mutation you explored is called a FRAMESHIFT mutation. Explain what this means and how it…
A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…
Q: Consider the following chart: What type of mutation is this? DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC…
A: By the translation process polypeptide chain is being synthesized from the mRNA sequence by the help…
Q: Orignal MRNA sequence: UCA ACA O GCA UAA AGU
A: Question - Original mRNA sequence : UCA Options - ACA GCA UAA AGU
Q: Sickle cell hemoglobin DNA CACG T AGACTGAGGA CAC Sickle cell hemoglobin MRNA ickle cell hemoglobin…
A: According to the question, we have to mention the type of mutation present in Sickle cell anemia…
Q: The coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: If the DNA duplex for the beta chain of haemoglobin 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' were…
A: Answer: TRANSCRIPTION = It is process of transcribing a strand of DNA using RNA polymerase which…
Q: If a gene for a polypeptide has a mutation that causes an amino acid change but the new amino acid…
A: Mutation is molecular change in the DNA sequence of a gene. Mutations in the coding sequence of a…
Q: Alpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the…
A: Alpha polypeptide (ADH1A)- Alcohol dehydrogenase 1A is a type of enzyme which in humans it is…
Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…
A: Disclaimer: " It is assumed that the given coding strand is from 5' to 3' direction. The central…
Q: Normal DNA: TGC GTG CTT AAG CGG TGT ACA CGT TGC mRNA: Animo Acid: 1st Mutation TGC GTG…
A: Mutations are sudden irreversible changes in the DNA sequence that arise due to ionizing radiations,…
Q: A protein has a mutation of a glycine to a lysine. Whát kind of mu tion Is th H HN *NH3 Glycine…
A: Mutations are the random changes in the genome of an organism.
Q: This CGT ACT GCA TCA GGC sequence of nucleotides is a referred to as sequence
A: Every biomolecules is a polymer made from a number of monomers. DNAs are the polymers of…
Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…
A: Gene expression is the process by which the instructions in the DNA are converted to functional…
Q: DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA…
A: DNA is the genetic material present in the cells of living beings.
Q: 3' A TAT --IIL 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 DNA C GU UGA UG G MRNA TRNA Amino…
A:
Q: Original DNA Sequence = TACACCTTGGCGACGACT MRNA Sequence ATGGAACCGCTGGTGA Amino Acid Sequence = U…
A: Mutations occur when there is a change in the DNA sequence. The minor change in the DNA sequence can…
Q: 1. DNA Sequence: TẠC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT…
A: As per our guidelines, we are supposed to answer only one question. Please repost other question in…
Q: rmal hemoglobin is created from the codon GAA, which codes for glutamic d while sickle-cell…
A: Any abrupt change in the DNA sequence of nucleotides results in mutation its effects may be diverse…
Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…
A: DNA is the genetic material present in our body and RNA encodes for protein molecules. DNA and RNA…
Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?
A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…
Q: B. Transcript and Translate the following: DNA-TACTGATCGACCCCCATA ATGAAAATCGGGCCC MRNA- AA- DNA -…
A: Coding DNA strand and mRNA has same sequence except T in DNA and U in RNA mRNA - Complementary to…
Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon…
A: A mutation is a permanent and heritable change in the nucleotide sequence of the DNA of an organism…
Q: A point mutation is a mutation that arises when one nucleotide in the genetic sequence is…
A: Mutation is the change in the DNA sequence or change in the entire chromosome that ultimately can…
Q: C G T G T G GAGCT A A.. 3' 5'..A TG GCG CTGTGA AGC TA A.. 3' 5 . .A TGG CGCT CTG GAGCTA A.. 3' on…
A: Mutations of the spontaneous change in the DNA molecule. Synonyms mutations does not change the…
Q: Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation?…
A: The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…
Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…
A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…
Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…
A: When there is an error in the DNA sequence during replication it causes a change in the DNA…
Q: TAC TGA TCG ACC CCC ATA ATG AAAAIC MRNA TRNA AA
A: The given sequence is anti-sense strand of the given gene. The anti-sense strand is in the direction…
Q: DNA MRNA > UCU GCC AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG protein > start - glu - ala…
A: The four major bases, commonly known as nucleotides, make up deoxyribonucleic acid (DNA). Adenine…
Q: The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And…
A: mRNA Sequence: A U G U G G A A C C G C U G C U G A Amino Acid Sequence: METHIONINE…
Q: Identify a protein that can contain a temperature-sensitive mutation that would explain these…
A: The mutation is the change in the nucleotide sequence that can be due to some chemical mutagens or…
Q: 42/ 50 The port mutation that doesn't produce a change in the amne act sequence of proten is known…
A: Introduction: A mutation is a change in our DNA sequence that happens as a result of errors in DNA…
Q: What is Mutation 2? a) Synonymous b) Read through c) Nonsynonymous d) Nonsense Mutation 2 ATA…
A: Mutations are sudden heritable change in the DNA sequence that alters the amino acids and then the…
Q: Original sequence Altered sequence protein/ amino acid mutation: DNA nucleotide AUUCGAGUA AUUCGGGUA…
A: A mutation is a sudden, stable and inheritable alteration in the base sequence of a gene which is…
Q: Sickle-cell anemia Work out amino acid sequences. CAC GTG GAC TG A GGA стс стс GTG CAC стG ACT сст…
A: Sickle cell anemia is genetic disorder which produces abnormal hemoglobin protein, because of which…
Q: What would happen if a mutation in DNA changed codon 6 in the mRNA to GUA? ( one nucleotide…
A: Sickle cell anemia disorder is characterized by the distorted shape of red blood cells such that…
Q: Define the following terms:a. repliconb. Okazaki fragmentc. ter regiond. tus proteine. preinitiation…
A: DNA replication is the transmission of chromosomal DNA from generation to generation is crucial to…
Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr.…
A: The DNA (deoxyribonucleic acid) codes for the peptide chain via transcription and translation. mRNA…
Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A…
A: Point mutations can be defined as mutations in single nucleotides. In point mutation, a nucleotide…
Q: Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.
A: Sickle cell anemia is the result of a point mutation in the hemoglobin gene. Sickle cell hemoglobin…
Q: A mutant is found that has the following protein sequence: Met Gly Thr Leu Arg Gly. What is the…
A: Mutation is defined as the alteration in gene that result in alteration in the function of the…
Q: "In this mutation, the AGC is transcribed into UAG." O missense mutation nonsense mutation O silent…
A: The replacement of a single base pair leads to the appearance of a codon i.e. stop codon, which is…
Q: Give the protein synthesized of the given mRNA sequence. No need to explain. Just give the answer.…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: 8. DNA → TAC AGA CGG CAA CTC TGG GTG CTT TGT TCT CTT CTC AGT ATC MRNA → protein >
A: The Central Dogma in molecular biology is one of the most important concepts which throws light on…
Q: Tn10 has a ____________ structure and it is composed of a pair of insertion sequence elements (IS10)…
A: Tn10 is a transposable element that instead of replication uses the method of cut and paste. It is…
Q: Type of mutation: Effect: Original Altered protein/ amino acid sequence sequence DNA nucleotide MRNA…
A: Original Sequence aLTERED sEQUENCE Type of mutation Effect mRNA AUUCGAGUA AUUCGGGUA Transition…
Q: The mRNA codon of valine is GUC UGG CCA TTG
A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…
Q: Туре of mutation: Effect: protein/ amino acid Original Altered sequence sequence DNA nucleotide MRNA…
A: A mutation is a change in the nucleotide sequence of an organism's genetic material (genome).…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 10- 00 O SCNSA-SCN10A CDKN1A HANDI VTI1A SYTI • MYOCD 9 10 11 12 13 14 15 16 17 18 19 20 2122 X YPLEASE MAKE THE DR BRUJIN GRAPH From these k-mers construct a de Bruijn graph and determine the sequence of the contig. AGCG ATCT ATGA ATGG ATTC CCCT CCTG CTCT CTGA CTGC CTTT GAAG GATT GCGT GCTC GTTC TATG TCAT TCTA TCTT TGAA TGAT TGGA TGTT TTCA TTCC TTTCBM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…Explain the meaning and relevance of the combining form myelo- seen in so many of these cell names.A web.lrnr.us/courses/6241c4b1-ef4f-41db-8549-34b0c315b9f4/assignments/da0b072b-ad10-40b1-a0cb-ecc2d2baf7f5/activities/c04d4b52-bb67- irrnr laquajajones Courses > Human AP I Laboratory > Assignments > 01 Microscope Lmr HW > Peering Into the Invisible World C9 Peering Into the Invisible World FIB with muitiple drop down entries 0. My Fill in the blanks, using the choices provided, to correctly identify the contributions to the Cell Theory. G2 In the late 1600s, a Dutch tailor who crafted lenses, used his primitive microscope to view pond water, the plaque In 1665, from his own oral cavity, as well as his own sperm. He referred to all of the organisms he viewed as coined the term to describe the cork tissue he was observing through a lens. You sign 91°F P Type here to search
- A web.lrnr.us/courses/6241c4b1-ef4f-41db-8549-34b0c315b9f4/assignments/da0b072b-ad10-40b1-a0cb-ecc2d2baf7f5/activities/c04d4b52-bb67- irrnr laquajajones Courses > Human AP I Laboratory > Assignments > 01 Microscope Lnr HW > Peering Into the Invisible World C) Peering Into the Invisible World FIB with muitiple drop down entries 0. My Fill in the blanks, using the choices provided, to correctly identify the contributions to the Cell Theory. G2 In the late 1600s, a Dutch tailor who crafted lenses, used his primitive microscope to view pond water, the plaque In 1665, from his own oral cavity, as well as his own sperm. He referred to all of the organisms he viewed as coined the term to describe the cork tissue he was observing through a lens. You sign 91°F P Type here to searchIf we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17C=U 36G=A 49G=U 115A=C 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’Give typing answer with explanation and conclusion The following gene codes for a liver enzyme. Changing the A/T base pair to which of the following would result in a missense mutation? 5’ GCCTAATATGCCCGTATGC(AGC)nCGAATAAAATAGTACGGTCGTCGC 3’ 3’ CGGATTATACGGGCATACG(TCG)nGCTTATTTT ATCATGCCAGCAGCG5’ A. C/G B. T/A C. G/C D. Any of the above E. 2 of the above F. None of the above
- The distal histidine stabilises the iron in heme group of a deoxyhaemoglobin. T/F5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationocument/d/1J-wo90GpYsd_jQSUBtDQHWisqGvSOteUQYoXaXazyS0/edit uction to cell.. R 1 Summary of Philo... E Petrona Andres Mig.. 2 Translations IXL: Par... IXL - Translations: g.. 1 IXL- meostasis Lab Exercise Tools Add-ons Help Last edit was 2 days ago text Calibri 12 BIU Conclusion: 1. List the changes you observed in the body color and perspiration level in response to? 2. Explain how the changes help the body adjust to maintain equilibrium (homeostasis)? 3. Speculate why a change in body temperature occurs? 4. Name which mechanisms your body uses to maintain a constant body temperature? 5. Explain why an increased breathing rate accompanies exercise? 6. Explain why an increased heart rate accompanies exercise? 7. Write a paragraph about the conclusions you can draw about your body's ability to maintain equilibrium (homeostasis). Be sure to include the answers to the questions above.