Q: Compare inductive reasoning with deductive reasoning.
A:
Q: A function emerges from the interaction of different parts of a biological system.
A: A biological system is a network of biologically significant entities. The biological system occurs…
Q: Give at least five research title or topics relating Biology.
A: The research title summarizes the main idea or ideas of your study.
Q: Currently, the common model of the human mind compares it to _____.
A: Psychological studies deals with all the products of human brain such as emotions, thoughts, memory,…
Q: THEORISTS THEIR THEORY EXPLANATION Faye Abdellah 21 NURSING PROBLEMS Myra Levine ENERGY…
A: Since we only answer up to 3 sub-parts, we'll answer the first 3. Please re-submit the question and…
Q: Which organizational level consists of related organs that work to achieve a common function? a.…
A: There is a certain hierarchy of the body system by which a whole body of an organism works. this…
Q: a description of the adaptation (what is the characteristic and how does it help this organism…
A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…
Q: Using images and correct anatomical terminology explain the location of the following organs of the…
A: Anatomists, zoologists, and health professionals such as doctors utilise anatomical terminology,…
Q: a short essay, discuss the levels of structural organization throughout the body. Discuss the…
A: Life processes, living things and their development and growth are distributed on the levels of…
Q: Summarize the concepts mentioned in the video. One sentence each concept if possible.…
A: Answer of the question given below...
Q: they are very diverse in their shapes and .structures
A: Some of the organisms don’t have tissues, organs, organ systems they have a body made of one cell…
Q: Is zygote a living being? Discuss it in the sense of the properties of life.
A: Zygote It is the cell resulting from the fertilization of a secondary oocyte by a sperm. The…
Q: The study of living things.
A: Living things are made up of single or multiple cells. They use energy to survive and possess the…
Q: How system decomposition and system interdependency are interacted with human body system draw a…
A: The physical substance of a human being, made up of living cells and extracellular materials…
Q: State True or False with explanation
A: Differential centrifugation is a method that is used for the separation of organelles and…
Q: branches of biology and its meaning
A: Biology is the science which deals with the study of livingorganisms. Living organisms are highly…
Q: Compare any processes in human body as open system and close system
A: *A system with no inputs is generally considered as the closed system where as a system with inputs…
Q: an example of a negative feedback loop
A: Negative feedback There are two type of feedback mechanism in biological systems 1. Positive…
Q: Examining how a neuron functions would be an example of study at the _______. tissue level…
A:
Q: Create a mind map with the following items as the central topic: Fish scales
A: A scale could be a little rigid plate that grows out of the skin of a fish. The skin of most jawed…
Q: Give 3 examples of feedback system
A: Feedback is outlined because the info gained a few reaction to a product, which is able to permit…
Q: the most intelligent order of animals on the planet.
A: Primates consists of mammals such as humans, apes, monkeys, lemurs, lorises etc...
Q: a description of the adaptation (what is the characteristic and how does it help this organism…
A: Golden poison drat frog is included in the phylum chordata and class amphibia. They have well…
Q: Briefly state the relationship between man, animal and the environment.
A: The surroundings in which the living entities survive or operate is called the environment. The…
Q: Anatomy: Label the structures in “Picture B" using the terms from the lab:
A: 1. notochord 2. Dorsal nerve cord 4. Pharynx 11. Incurrent siphon 12. Excurrent siphon 13. Heart…
Q: Essay tests require ____________________ of facts or ideas
A: Essay tests require tends to focus of facts and ideas.
Q: Levels of biological organization
A: Levels of organisation are natural systems that are frequently described by part-whole…
Q: Explain and summarize the terms and ideas.
A: ✓Hormones is the main key point for action of endocrine system which ✓Hormones influence growth,…
Q: Contrast inductive reasoning with deductive reasoning.
A: Inductive reasoning is the formulation of the new theory after many observations and deductive…
Q: Can any one help me with this ? I am making notes on diagrams. I want someone to describe given…
A: Glucose is the primary substrate for cellular respiration. Glycolysis is an oxidative process in…
Q: Define Concept of phycology , Discus Biology concept of psychology, also discuss the nervous system
A: Biology is a wide field that studies life from a variety of angles. The growth of research unique to…
Q: nswer with explanation.
A: As a nurse its her responsibility to remember the formula while calculating the drug to avoid…
Q: Communication Techniques - definition and give one example each.
A: Communication is one of the key instrumental element in nursing because it helps in exchanging the…
Q: Characteristics of living things
A: The characteristics of non-living thing are as follows- a. The non-living thing do not require air,…
Q: Research Statement 5 3 Strongly Agree Neither Disagree Strongly Agree Disagree 1.1 can understand…
A: Hypothesis -- A hypothesis shows the work has been done on some basic principles and how much,…
Q: Lists cost and benefits of group living in animals.
A: Animals often live in groups. However, group living has both benefits as well as costs. One…
Q: The unique role of an organism
A: An organism is a living thing that refers to prokaryotes (bacteria and archaea) and eukaryotes…
Q: ________ is the study of how living organisms interact with each other and their environment.
A: Introduction: The ways in which living organisms interact with each other and their environment are…
Q: Who observed tiny living organisms
A: Introduction: Microbes are referred to as tiny living organisms. they are omnipresent and too small…
Q: Research on how some organisms maintain steady internal conditions that possess various structures…
A: Homeostasis is the mechanism of maintaining a constant internal state in a multicellular organism's…
Q: What is symmetry
A: To define: To explain what is symmetry and its types
Q: proper explanation and diagram
A: We are answering 3 parts For remaining parts pls repost
Q: debating whether or not we should do certain things in biology is called?
A: Biology is about studying the structure, functions, and other aspects of living things.
Q: why general biology is important
A: As a field of science, biology allows us to understand, develop, and communicate with the living…
Q: Hypothesis construction Experimental testing Data analysis Prior Hynothes
A: A hypothesis needs to be something which cannot be objectively tested. Hypothesis can be those…
Q: Interpret clearly and explain the information presented in this graph
A: Figure : The diagram shows that the catalyst allows the reaction to take place through a different…
Q: The change in an organism resulting due to stimulus called.
A: An ecosystem is a large community of living organisms in a specific area in which the biotic and…
Q: explain A GLANCE IN THE MIRROR MORPH INTO A REFLECTIVE-REFLEXIVE PRACTITIONER
A: Nursing is a career. Nursing is more than just a collection of specialized skills, and the nurse is…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- ty of Indianapolis : 20202 X ace.uindy.edu/portal/site/202020-BIOL-104-07/tool/2e4f1021-614d-4fae-83d6-ff99ca3767e0/jsf/delivery/beginTakingAssessment M Gmail YouTube Maps A ApneTV Home of H... What is the first step in protein synthesis? O A. making an RNA copy of the DNA within the nucleus B. making a sequence of amino acids O C. forming peptide bonds between amino acids OD. making a copy of RNA with DNA outside the nucleus Reset SelectionBased on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGContent C b. Biol 1406-Lec 17 Gene Exp X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Blackboard Learn q Which of the following statements about gene regulation is not true? O RNA interference is the inhibition of mRNA translation by siRNA's or miRNA's literally blocking access to the mRNA transcript or causing it to degrade. O X GWhich of the following staten X QUESTION 8 Paraphrasing Tool - QuillBot Al x Your disk is almost full Save space by optimizing st Alternative RNA splicing in eukaryotes can produce many different polypeptides from a single mRNA sequence by interpreting differing mRNA segments as introns or exons and splicing them accordingly. O DNA methylation can reduce or halt DNA transcription as DNA is negatively charged and the added methyl is negatively charged causing the methylated DNA to supercoil becoming inaccessible to RNA polymerase. O Some operons such as the lac operon can be controlled through both positive and negative gene regulation. O…
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene? Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
- 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAGDNA, RNA, AND PROTEIN SYNTHESIS (FILL IN THE BLANKS) GIVEN THE FOLLOWING CODING SEQUENCE FOR DNA, PROVIDE THE SEQUENCE OF THE COMPLEMENTARY(TEMPLATE) SEQUENCE. CODING SEQUENCE/ 5' ATGCATAGATTAGGATATCCCAGATAG 3' COMPLEMENTARY SEQUENCE: 3' ______________________________ 5' CODING SEQUENCE ~ mRNA transcript: 5' _______________________ 3' TRANSLATE THE GIVEN mRNA TRANSCRIPT INTO A POLYPEPTIDE SEQUENCE (REFER TO THE GENETIC CODE) POLYPEPTIDE SEQUENCE: _________________________________Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 15 Residue Number ILYYAGSREDHSGYLIL EQSDTERNQHGALIYLI LIFLAIFPAGSTSEDRR RAFLILFMTYFLILFLI LHGDQNRERDGHSQERD 2 Hydropathy value 0 -4 -2
- 10:14 Protein 5-10092015113503.pdf https:api.schoology.comv1attachment169963838... Name Class Date RNA (pages 146-148) | SECTION REVIEW In this section you were introduced to the molecule that helps put the information in DNA to use: ribonucleic acid, or RNA. ANA Iis a nucleic acid that carries information from DNA to the ribosomes, the organelles in which proteins are made. RNA also carries out the process by which proteins are assem- bled from amino acids. RNA is quite similar to DNA in structure. However, there are some important differ- ences. RNA is single-stranded; DNA is dou- ble-stranded. RNA contains the sugar ribose; DNA contains deoxyribose. And RNA has the nitrogenous base uracil; DNA has thymine. In this section you also learned about the process of transcription. Transcription is t process in which part of a DNA molecule is used as a template for the synthesis of a com- plementary strand of RNA. This process is mediated by an enzyme called RNA poly- merase. The strand of…Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.