please can you fill in the c++ code in this screenshot while adding professional comments using the // command after each code thank you #include >using namespace std;int main(){// summing variable// input value// Add code: Declare an int here for the loop counter// Add code: Declare an int here for the loop total// Add code: Set the loop counter to 0int sum = 0;int dataValue;// Add code: Prompt the user for how many numbers they want to addie. the loop total//// Add code: Read the loop total// Add code: Write a while statement that comparesyour loop counter to your loop totaleg. while (loopctr< looptotal)Note: the variable names depend on how you declared them.//////{cout << "Enter an integer value. Press return." << endl;cin >> dataValue;sum = sun + dataValue;// Add code: Increment your loop counter variable} // end of while loop blockcout << endl<<< "The sum is << sum << endl;return 0;

#include using namespace std; int main() { int sum = 0; // summing variable // input value int dataValue; // Add code: Declare an int here for the loop counter // Add code: Declare an int here for the loop total // Add code: Set the loop counter to 0 // Add code: Prompt the user for how many numbers they want to add 11 ie. the loop total // Add code: Read the loop total // Add code: Write a while statement that compares 11 your loop counter to your loop total 11 eg. while (loopctr< looptotal) 11 Note: the variable names depend on how you declared them. { cout << "Enter an integer value. Press return." << endl; cin >> dataValue; sum = sum + dataValue; // Add code: Increment your loop counter variable } // end of while loop block cout << endl<<< "The sum is << sum << endl; . return 0;

#include using namespace std; int main() { int sum = 0; // summing variable // input value int dataValue; // Add code: Declare an int here for the loop counter // Add code: Declare an int here for the loop total // Add code: Set the loop counter to 0 // Add code: Prompt the user for how many numbers they want to add 11 ie. the loop total // Add code: Read the loop total // Add code: Write a while statement that compares 11 your loop counter to your loop total 11 eg. while (loopctr< looptotal) 11 Note: the variable names depend on how you declared them. { cout << "Enter an integer value. Press return." << endl; cin >> dataValue; sum = sum + dataValue; // Add code: Increment your loop counter variable } // end of while loop block cout << endl<<< "The sum is << sum << endl; . return 0;

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter5: Repetition Statements

Section: Chapter Questions

Problem 7PP

See similar textbooks

Similar questions

C++ code using while loop and do while loop (no function or array allowed) for this task
Looping Construct with Floating Point Numbers Write a program that utilizes a while-loop to read a set of five floating-point values from user input. Include code to prevent an endless loop. Ask the user to enter the values, then print the following data: Total Average Maximum Minimum Interest on total at 20% Answer:
C++ programming Write a program that reads the grades of 3 students in three different courses and displays the average grade of each student in these three courses, as well as the average grade of all students. You can use any loop method of your preference. (Hint: This is a nested loop technique)
JAVA CODE PLEASE FINAL EXAM Part 3 Instructions: Create a java program that asks & accepts input from the user (must be int value). Then depending on the number of inputs, the program will ask the user to enter string value/s. After, the program will print the strings entered by the user line-by-line. Constraints: Create a function and call it in the main function. Use Functions With No Parameters and Return Values Use for Loop Use String Array Use Scanner Input 1. One line containing an integer Sample 2 2. One line containing string Sample Funny 3. One line containing string Sample Sadly Output Enter·the·number·of·string·array:·2 Enter·string·#1:·Funny Enter·string·#2:·Sadly You've·entered: Funny Sadly
C++ Coding: Nested Loops Create a constant DIM. Set DIM to 7, and use a nested loop to display the following square matrix output. Output Example: - - - X - - -- - - X - - -- - - X - - -X X X O X X X- - - X - - -- - - X - - -- - - X - - -
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
C++ LOOPING ACTIVITY write a program to check whether the character is in digit, lowercase, uppercase, special character in C++ using while or do loop. Screen 1: Enter any character: Screen 2: _is a digit _is a lowercase alphabet _is a uppercase alphabet is a special character Press
Java: Yellow highlighted columns are outer ‘for’ loop Blue highlighted columns are inner ‘for’ loop
Direction: Read each sentence/ situation carefully and select the BEST answer among the choices. 1. It is a Boolean expression that tells when the loop will exit. 2. The sequence that makes up the loop body may either be a block of Turbo C statements or a single Turbo C statement. 3. In Turbo C it is a reserved word. 4. Its values determine the number of times the loop iterates. 5. It is the second type of open-ended loop. Condition For Loop Statement For Do while Loop
// SumAndProduct.cpp - This program computes sums and products // Input: Interactive// Output: Computed sum and product #include <iostream>#include <string>void sums(int);void products(int);using namespace std; int main() { int number; cout << "Enter a positive integer or 0 to quit: "; cin >> number; while(number != 0) { // Call sums function here // Call products function here cout << "Enter a positive integer or 0 to quit: "; cin >> number; } return 0;} // End of main function// Write sums function here// Write products function here
When you perform arithmetic operations with operands of different types, such as adding an int and a float, ____________. C# chooses a unifying type for the result you must choose a unifying type for the result you must provide a cast you receive an error message
(Numerical) Write and test a function that returns the position of the largest and smallest values in an array of double-precision numbers.