In the traditional alkaline lysis method of Solution 1, what is the purpose of Glucose
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the…
A: The proteins are constituted of twenty naturally occurring amino acids. Each amino acid is encoded…
Q: How much 4x loading dye should be added to 11 uL of DNA? Report you answer in units of uL, with one…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: If the enzyme maltase has a Vo of 0.25 mM per minute when [S] = 0.10 mM, and a Vo of 0.40 mM per…
A: Enzymes kinetics - is the study of the reaction rate of enzyme catalyzed reactions. The reaction…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: Consider the following α helix from myoglobin at pH 7.…
A: Proteins are folded polypeptides. Polypeptides are amino acid polymers linked to each other via a…
Q: myristic acid (14:0) to carbon dioxide and water a. rounds of the beta oxidation pathway will be…
A: Beta oxidation is a collection of 4 enzymatically catalysed reactions that cleave 2 carbon at a time…
Q: The figure above represents changes in different types of metabolic pathways (y-axis) as energy…
A: Metabolism is the sum of all biochemical reactions in a living system that are responsible for it's…
Q: Digestion of proteins in the stomach and intestines. Absorption of digestion products.
A: Proteins are high molecular-weight polymers of amino acid residues. Proteins serve diverse…
Q: Which of these is not a suitable test for assessing folate status? red cell folate plasma…
A: Folate formerly known as folacin is a water soluble vitamin B or B9 usually found in some foods…
Q: 7. Some toxins block the synthesis of mRNA or proteins. Why would this effect be toxic, and how…
A: mRNA is the intermediate molecule between DNA and protein, carrying the genetic information encoded…
Q: A new amino acid is found with the alpha N and backbone COOH pKa's the same as histidine but with a…
A: Amino acids are building blocks of proteins and peptides. Alpha carbon of amino acids consist of…
Q: ) Describe the 10 enzymatic reactions of glycolysis and the organization of the pathway in 2 main…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Q: In a folded protein, Glu116 is close in three-dimensional space to Lys224. The pKa of the carboxylic…
A: pKa is the pH at which a weak acid is 50% dissociated. Alternatively, pKa = -log Ka. In acid-base…
Q: Which type of protein is classified by a polypeptide which is arranged in long strands or sheets?…
A: Each and every live cell has proteins. Protoplasm, cell membranes, and nuclear material all include…
Q: 1.c)B vitamins are involved in energy production. must be injected to be effective. are fat-soluble.…
A: B vitamins are water soluble vitamins which are of classified into 8 types. they are Thymine ,…
Q: 1.a)Which one of the following diseases is caused by an iodine deficiency? pellagra goiter night…
A: Iodine deficiency is a condition in which the body does not have enough iodine to produce thyroid…
Q: A patient was admitted to the hospital with suspicion of malaria. After the examination was complete…
A: Glucose-6-phosphate dehydrogenase (G6PD) is an enzyme involved in pentose phosphate pathway. Malaria…
Q: 2. In one paragraph, refute or support the statement: "Photosynthesis and oxidative phosphorylation…
A: There are a lot of metabolic processes that essential serve the opposite purposes of each other.…
Q: Calculate the more fraction of HC! hydrochloric water containing 30% HCl and water in a folution…
A: Mole fraction is a fraction of the number of moles of a particular component in a mixture divided by…
Q: Inhibitors are important in developing new pharmaceuticals. Two important classes of inhibitors…
A: Inhibitors are molecules or compounds that reduce the rate of a chemical reaction, or block it…
Q: In the same oak leaf that absorbed 15,440 photons, how many CO2 molecules are fixed to produce the…
A: The Calvin cycle is a series of biochemical reactions that occur during the light-independent phase…
Q: Bile acids: localization of synthesis, their biochemical significance.
A: Introduction Cholesterol is a compound which is essential for our body. Cholesterol is synthesised…
Q: Qualitative Tests for Carbohydrates: Sugar Solution Glucose Sucrose Lactose Hydrolysis: Molisch's…
A: Qualitative tests for carbohydrates are done to confirm the presence of carbohydrates in a sample,…
Q: A. Draw the structure of the following peptide sequence at pH 2.0: ASP-ALA-THR-LYS-GLY B. What is…
A: Amino acids are basic building blocks of polypeptides, and one or more of these polypeptides they…
Q: Consider the amino acid aspartic acid for this problem. Aspartic acid can be considered a triprotic…
A: Aspartic acid have 3 ionizable groups in it. They are; alpha- carboxyl group alpha-amino group…
Q: Explain the difference between ΔG°’ and ΔG and calculate the free energy (delta G) of hydrolysis of…
A: In chemical and especially biochemical systems (like cells), we are concerned more about the energy…
Q: Experiment A. You replace spiperone with a radiolabelled drug that has a higher affinity for the D₂…
A: The log dose-occupancy curve is a graph that shows the relationship between the concentration of a…
Q: Peptides have been discovered that display anti-inflammatory properties and show promise as new…
A: MTADV is a synthetic pentapeptide which can be a potential novel drug with anti-inflammatory…
Q: Provide a simple sketch of the covalent intermediate likely to form between active site serine…
A: Serine, histidine, and aspartate all are amino acids. They all have different properties and…
Q: In the liver, higher levels of NADH promote gluconeogenesis. I'm curious as to your thoughts on this…
A: Gluconeogenesis is defined as the de novo synthesis of glucose from a non-hexose or non-carbohydrate…
Q: For the electrophoresis at 25°C of two proteins, in a medium with a viscosity of 0.001kg/m-s, the…
A: Electrophoresis is a technique used in biotechnology to separate and analyze biological molecules…
Q: True and false - A k+ channel will be just as permeable to Na+ as to K+ because Na+ is a smaller ion…
A: Ion channels are proteins that form pores in the plasma membrane and allow ions to pass through in…
Q: 3. If PCR were performed on a highly conserved gene from two species, one prokaryotic and one…
A: A conserved gene is a gene that has remained largely unchanged over a long period of evolutionary…
Q: OH HO "OH Enzyme A 0= отва OH OH HO OH
A: Glycolysis is a metabolic pathway that converts glucose into pyruvate. The site of this metabolism…
Q: 1. Draw the structure of a cholesterol ester where cholesterol is esterified with palmitic acid. is…
A: The four classes of biological macromolecules are nucleic acids, proteins, lipids and carbohydrates.…
Q: T F T F T F T T F F T F T F Vmax is the velocity observed when all of the enzyme present is fully…
A: The kinetics of an enzyme-catalyzed reaction can be described using a variety of parameters,…
Q: 1)s. Name an enzyme that requires NAD/NADH for activity. Draw the chemistry of this reaction (show…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 3. A student in my lab was trying to express the cytosolic (not membrane bound) enzyme PseG and…
A: The expression of proteins in a prokaryotic or eukaryotic cell involves transcription and…
Q: The glycolytic enzyme aldolase catalyzes the following cleavage reaction: Fructose 1,6-bisphosphate…
A: Aldolase is an enzyme that catalyses one of the reaction of glycolytic pathway by performing a…
Q: The high phosphoryl transfer potential of 1,3-bisphosphoglycerate is explained by the resonance…
A: Resonance stabilization is a phenomenon in which resonance allows the delocalization of electrons to…
Q: 6. List four (4) organelle structures that are similar for both plant and animal cells. List the…
A: Cell organelles, or simply Organelles, are subunits present in a cell responsible for carrying out…
Q: (ii) Shown below is a section of a canonical TFO. Discuss, in detail, chemical modifications that…
A: Triplex forming oligonucleotides (TFO) are single stranded homopyrimidine/homopurine oligonucleotide…
Q: The standard Gibbs (free) energy of reaction (A,Gº') of the following reaction is equal to zero (at…
A: Gibbs free energy is the energy released by a reaction when proceeded under constant temperature and…
Q: Some scientists debate whether it is correct to consider pyruvate as “the end of glycolysis”.…
A: Introduction All living organisms require energy. They get energy from cellular respiration.…
Q: In the folded protein, His108 forms a salt bridge with Asp44. The pKa of the imidazole functional…
A: pKa is the pH at which a weak acid is 50% dissociated into H+ and conjugate base. Also, pKa = -log…
Q: Basal Metabolic Rate (BMR) is the amount of energy your body uses to function at rest in a day. This…
A: The Total Daily Energy Expenditure (TDEE) is the amount of energy an individual burns in a day,…
Q: 9. Briefly describe and draw the structure of the following disaccharides in their ring structure.…
A: A. Sucrose structure: O O| || || |O-C-O-C-H H-C-O-C-O| || || |H H B. Maltose structure: O O| || ||…
Q: 1. Lyticase is an enzyme that breaks down cell membranes. It is particularly useful when harvesting…
A: During enzyme kinetics, the primary plot we use is the Michaelis-Menten plot with [S] as X-axis and…
Q: How does the bicarbonate buffer system of the mammalian blood plasma function?
A: The bicarbonate buffer system is a mechanism by which the pH of the blood is maintained between 7.34…
Q: 3) Which statement explains a way in which a researcher could cause a cytoplasmic protein to…
A: process of transporting cytoplasmic proteins into the nucleus 1. cytoplasmic protein contains an NLS…
In the traditional alkaline lysis method of Solution 1, what is the purpose of Glucosel?
Step by step
Solved in 2 steps
- How to prepare %25 100 ml Glucose solution?How do you calculate the amount of ammonium sulfate necessary to get a 20% solution?Are Xanthoproteic and MillonNasse tests satisfactory for use in the urinary examination for protein? Why? Which test can be used to show up to what stage the hydrolysis of a protein proceeds? Why?
- Urease breaks down urea into what product? What color is an indication of a positive urease test?The following structure is D-sorbose. Which reagent will oxidize D-sorbose? CH2OH C = 0 Н-С-ОН НО - С - Н Н-С-ОН CH2OH Benedict's reagent None of the above Sodium hydroxide Tollen's reagent Barfoed's reagentDescribe the effect of the following changes would have on the rate of a reaction that involves the substrate UREA and the liver enzyme UREASE 1. Increasing the UREA concentration 2. Increasing the UREASE concentration 3. Increasing the temperature from its optimum value to a value 10degree higher than this value 4. Lowering the pH from the optimum value of 5.0 to a value of 3.0
- An iodine solution was sealed inside dialysis tubing, then immersed in a cup of water containing fructose and starch and allowed to react. Recall that iodine solution is red, Iodine + starch = purple. After reaction a) the color outside the dialysis bag would be (red, purple, clear) b) the color inside the bag would be purple (true/false) c) fructose would be present inside the dialysis bag (true/false)A disk-diffusion test using E. coli gave the following results: Disinfectant Zone of inhibition (diameter in mm) A 15 B 2.0 C 10 D 5 In the table above, which compound was the most effective against E. coli? A) A B) B C) C D) D E) The answer cannot be determined based on the information provided.In urea hydrolysis what emd product is specifically being tested for in this test? Is the final ph of the tube acidic, alkaline or neutral?