In class, we discussed the regulation of expression of the Trp biosynthesis enzymes. These are the enzymes that make Trp amino acid. Fill in the following table. Environmental Condition Fed Trp amino acid NOT fed Trp amino acid Which proteins bind to the Trp Promoter Not fed. Fed the. Are Trp biosynthesis enzymes transcribed? (Yes or No) yes yes

In class, we discussed the regulation of expression of the Trp biosynthesis enzymes. These are the enzymes that make Trp amino acid. Fill in the following table. Environmental Condition Fed Trp amino acid NOT fed Trp amino acid Which proteins bind to the Trp Promoter Not fed. Fed the. Are Trp biosynthesis enzymes transcribed? (Yes or No) yes yes

Name: In class, we discussed the regulation of expression of the Trp biosyn
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: In class, we discussed the regulation of expression of the Trp biosynthesis enzymes. These are theenzymes that make Trp amino acid. Fill in the following table.Environmental ConditionFed Trp amino acidNOT fed Trp amino acidWhich proteinsbind to the

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 13QP: Suppose that in the formation of phenylalanine hydroxylase mRNA, the exons of the pre-mRNA fail to...

See similar textbooks

Similar questions

Suppose that in the formation of phenylalanine hydroxylase mRNA, the exons of the pre-mRNA fail to splice together properly and the resulting enzyme is nonfunctional. This produces an accumulation of high levels of phenylalanine and other compounds, which causes neurological damage. What phenotype would be produced in the affected individual?
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
Suppose that you have cancer cell line X was treated with drug Y toincrease the expression levels of protein Z which is a tumorsuppressor gene.Explain How can you study protein Z in these cells? (no need for these qustions)Explain how can you study protein Z components? (needed)
. An interesting mutation in lacI results in repressorswith 110-fold increased binding to both operator andnonoperator DNA. These repressors display a “reverse”induction curve, allowing β-galactosidase synthesis inthe absence of an inducer (IPTG) but partly repressingβ-galactosidase expression in the presence of IPTG. Howcan you explain this? (Note that, when IPTG binds a repressor, it does not completely destroy operator affinity,but rather it reduces affinity 110-fold. Additionally, ascells divide and new operators are generated by thesynthesis of daughter strands, the repressor must findthe new operators by searching along the DNA, rapidlybinding to nonoperator sequences and dissociating fromthem.)
Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a transcription factor. You have identified a novel variant in WT1: Arg422Pro. You have control cells and cells that have been engineered to carry the homozygous WT1 p.Arg422Pro mutation. You want to assess effects of this mutation on a variety of endpoints. For each endpoint listed below, choose the one technique is best suited to answer the question. Choose from: array CGH, qRT-PCR, qPCR, RNA-seq, FISH, in situ hybridization, western blot, immunostaining, WT1 ChIP-seq, WT1 ChIP-PCR, ATAC-seq, 3C Endpoint Technique? WT1 protein amount (quantitative) Western blot WT1 protein binding to all enhancers, genome-wide Chip-seq WT1 mRNA amount (quantitative) WT1 protein subcellular localization Quantitative assessment of all mRNAs in these cells (genome-wide) RNAseq Chromatin interactions between a specific WT1 chromatin binding site (identified above)…
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC AAGCTCGAGAGCAСCAGCTСТАТGCGСТАСТАТААТGAССАКТАТАСССТАCGTGATAG 5" 3' RNA promoter polymerase 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? 4b. What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' --- 4c. What are the first 5 amino acids encoded by this gene? )Note - there is a codon table available at the beginning of this exam. N' C' 4d. Will translation stop at the UAA which begins at position 41? Explain your logic 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new…
Phorbol esters have been observed to induce the transcription of AP-1–influenced genes. Explain how this processcould occur. What are the consequences of AP-1 transcription? What role does intermittent exposure to phorbol estershave on an individual’s health?
In the normal cycle of Ras activity, when Ras is bound to y activity that removes a phosphate to convert GTP back to GDP and this it is inactive. Activation of Ras involves exchanging GDP for The Ras protein has intrinsic Ras. inactivates activates ATP GTP «< Questic A Moving to another question will save this response. ADP GDP GTPase Clo nuclease
The following diagram depicts the elements at the: 999 2 cacc tata as tatafan A ACG TTC ATT BRE TATA box Inr DPE (TBP) TFIIB TFIID O Promoter Enhancer transcribed gene Silencer
Suppose that you have cancer cell line X was treated with drug Y toincrease the expression levels of protein Z which is a tumorsuppressor gene. (no need for this qustion)Explain How can you study protein Z in these cells? (needed)
Relative H3/H4 Acetylation Relative H4 Acetylation Relative НЗ Асetylation IION --- -4Kb -3Kb -2Kb -1Kb +1 Insulin You are studying histone modification at the insulin gene in cell types that express insulin (3 & A 4) compared to cell types that do not express insulin (1 & 2). eria Enhancer Promoter 20 15 10 5 Discuss with your pod: In which cell type(s) is H3 acetylation highest? 2. In which cell type(s) is H4 acetylation highest? 3. Is histone acetylation the same at the enhancer and promoter? 4. Based on the data, which histone modification is most important for activating insulin gene expression? 0- 1. 20 De 15 10 C
LysR regulators like llvY repress transcription from their own promoters. This is called a negative feedback loop. Why might negative feedback be a good way to control expression of a transcriptional repressor? This type of negative feedback loop ensures that ilvC transcription will always be repressed when llvY levels are low, and ilvC will be transcribed highly when llvY levels are high. This type of negative feedback regulation ensures that ilvY is never transcribed. Since llvY is a transcriptional repressor, it will slow down cell growth by blocking transcription. So, llvY represses it's own transcription so that no llvY can ever be made, and the cell can grow. This type of negative feedback loop ensures that there is always a moderate amount of llvY. When IlvY levels fall too low, transcription from the promoter will increase since IlvY won't be able to repress it's own promoter. This negative feedback also ensures that IlVY levels don't rise too high - when llvY levels are high,…