I. Name the following carbohydrates using the proper way of naming/IUPAC system a Erythrose b. Lyxose C. Arabinose d. Mannose e. Gulose f. Psicose g. Sorbose h. Ribulose Tagatose j. Dihydroxyacetone 1.
Q: Is it still possible to find polysaccharides in the result of starch hydrolysis? What tests may have…
A: Starch is the carbohydrate made up of several glucose molecules linked together by glyosidic…
Q: -Which of the following is/are ketone bodies: a. B-hydroxybutyrate b. Acetone C. Acetoacetate d.…
A: Ketone bodies are an alternative fuel for the body when there is shortage of glucose. They are made…
Q: List 3 complex carbohydrates 1. Plant-derived digestible carbohydrate 2. Plant-derived…
A: Carbohydrates are an important source of energy for all living cells. Glucose is an important…
Q: Write down the abbreviations (both 1 letter and 3 letter) for the amino acids given below:…
A: Amino acids contain an alpha-carboxylic acid group and an alpha-amino group. Glycine is the simplest…
Q: Which of the following is/are derived from isoprene? (Select all that apply!) __ A __ B __ C __…
A: One isoprene unit is represented by C5H8 and it is also called as the hemiterpene. Biosynthesis of…
Q: These are found in soybean oil (select all that apply). Polyunsaturated fatty acids…
A: Soybean oil is extracted from the seeds of the Glycine max(Soybean).This oil is widely used as…
Q: Which of the following is/are NOT (an) essential fatty acids? A. arachidonic acid B. linoleic acid…
A: Essential fatty acids can be defined as those fatty acids which body cannot synthesis but are…
Q: It has long been recognized that breast milk protects infantsfrom infectious diseases, especially…
A: Human milk oligosaccharides also known as human milk glycans are short polymers of simple sugars…
Q: Which of the following monosaccharide is not a part of biomarkers for blood? O a-D-galactose o…
A: Monosaccharides: a. Monosaccharide means single saccharide, which is the simplest form of sugar. b.…
Q: 9.The disaccharide given is CH;OH O OH CH2OH OH OH Он ÓH A. Sucrose B. Lactose C. Maltose D.…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which…
Q: Discuss the ease of hydrolysis (break down) for each of the 4 polysaccharides (glycogen, amylose,…
A: Food is an important energy source to carry on the normal physiological functions of the body.…
Q: I. True or False. Write the word "reducing" if the statement is correct otherwise write…
A:
Q: What are F and E? (circle the correct answer): a. Enantiomers b. Diastereoisomers c. Epimers…
A: Epimers are the diastereomers that have the opposite configuration at only one of two or more chiral…
Q: 1- Resorcinol 1- trisaccharides 2- a(1-2)ß 3- structural polysaccharides 4- monoreducing sugars. 5-…
A:
Q: Explain your answer in 1-3 sentences only. FOLLOW INSTRUCTION! 1. Which of the following is an alpha…
A: 1. Which of the following is an alpha lactone? Ans: Vit D 1 alpha,25(R)- dihydroxy vitamin D3 26,…
Q: Which of the following are saponifiable lipids? (Recall that ester bonds are broken by base…
A: A saponifiable lipid is part of the ester functional group. They are made up of long chain…
Q: CH-CH NH C-NHCH 林 H3C HN A B C D Look at chemical structure and chose true chemical group added to…
A: Histamine is an immunomodulatory compound. Some of the immune responses such as inflammation and…
Q: Name the ff. carbohydrates: erythrose lyxose arabinose mannose gulose psicose sorbose…
A: Carbohydrates are polyhydroxy aldehydes or ketones that are associated with reducing properties.…
Q: ldentify the Fischer projection A to D that matches each of the following: (15.1, 15.3) the L…
A: Fisher projection is used to depict three-dimensional compounds into two-dimensional. Enantiomers or…
Q: СНО CH2OH H-Ć-OH H-C-OH H- HO- C=0 H-C-OH H- -HO- HO-C-H H-Ć-OH CH2OH ČH;OH CH,OH
A: Monosaccharides represent the basic form of carbohydrate and it consists of a linear unbranched…
Q: The major structural differences between cellulose and starch is found in the’ (a) I identify of the…
A: Carbohydrates: It is the energy source for the body represented by the formula (CH2O)n, where n is…
Q: I. Name the following carbohydrates using the proper way of naming/IUPAC system. a. Erythrose b.…
A: Carbohydrates are the primary source of energy for the body. Glucose is the simplest form of…
Q: What is the molecule below? A. Tetrahydrofolate B. 5-adenosyl methionine C. Pyridoxal…
A: Coenzymes are substances that enhance enzymatic activity by binding to the enzyme. coenzymes are the…
Q: Which of these polymers contains α1à6 glycosidic linkages? (Select all that apply!) a) Starch b)…
A: Polysaccharides are carbohydrates that contain many monosaccharides that are linked through O…
Q: Which of the following saccharides is INCORRECTLY described? * A. D-mannose: Monosaccharide:…
A: Carbohydrates are macronutrients that the body requires for energy production. Carbohydrates provide…
Q: The Disaccharide Maltose is formed by a (an): O a. a(1- 2) O-glycosidic bond between 2 glucose…
A: Maltose is a disaccharide composed of two monosaccharides attached together via a glycosidic bond.
Q: Cyclization of monosaccharides: A Aldopentoses can form both pyran and fu- ran rings. B] Pyran rings…
A: Monosaccharides with aldehyde or keto group under normal conditions cyclize and form a ring…
Q: As observed in the LipidBank database, the lipopolysaccharide referred to as Lipid A from…
A:
Q: POI; which of the following group is present in tryptophan a. Indole group b. Imidazole group c.…
A: Following are the different types of amino acids and their specific groups:- -Arginine- contains…
Q: As observed in the LipidBank database, the lipopolysaccharide referred to as Lipid A from…
A: The cell of a gram positive bacterium is composed of cytoplasm, plasma membrane, cell wall, and a…
Q: a. Construct a typical wax derived from palmitic acid. No sticks are acceptable. CH2 groups can be…
A: Waxes are esters of long-chain fatty acids and monohydroxy alcohols. They are highly insoluble. The…
Q: Detection of starch in food requires the addition of lodine .a O Sudan Red .b O Sodium .c O Gelatin…
A: Starch is the stored form of glucose in plants ,which means that plants reserve the glucose in the…
Q: Define the following terms: a. ganglioside b. sphingolipidoses c. isoprenoid d. terpene e. mixed…
A: Glycolipids are considered as the mixed compound of lipids with carbohydrates, that are attached…
Q: When this disaccharide is formed.... Select one: a. An alpha-beta-1,2-glycosidic bond is created b.…
A: Oligosaccharides are formed by connecting monosaccharides via glycosidic linkages.
Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Tagatose is ketohexose i.e. it has 6 carbons and is a ketose sugar.
Q: Consider the trisaccharide below and answer the following questions: CHOH ON OH HO HOH C CH,OH OH…
A: Macromolecules are huge polymers made up of several monomers linked by covalent connections.…
Q: Common names for some triacylglycerols depend on their source. Identify the source. Choices are…
A: Triacyclglycerols is a compound made up of glycerol and three fatty acids. They constitute most of…
Q: What is your opinion about consuming food that contains cyanogenic glycosides? Is it the same for…
A: Cyanogenic glycosides are natural plant toxins that are present in several plants, most of which are…
Q: Which of the following statements about Lipopolysaccharide is FALSE? O The lipid A portion is a form…
A: LPS is produced by the gut microbiome and it is a lipid-polysaccharide found in the outer membrane…
Q: monosaccharide theoretically form diverse disaccharides
A:
Q: Conc. H,SO, a-naphthol (*) Conc. HSO, acetic anhydrde Orcinol, FeCi, HCI A () Cu(CH,COO), acetic…
A: The schematic diagram that is represented is showing the results of different biochemical tests for…
Q: The correct systematic name for the fatty acid below is: a) 3 octadecatrienoic acid b) 9…
A: Ans - Carboxyl carbon (- COOH) would be given first number in order to start numbering and naming of…
Q: D Clositol L Sorbitol Why does it have two names?
A: Asked : D Clositol L Sorbitol two names reason.
Q: Which of the following types of fat is required to be listed on the Nutrition Facts Panel by the U.S…
A: Answer- A.Trans fatty acid
Q: Lipids may originate through carbocation-based condensation of thioesters or by carbanion-based…
A: Lipids are a class of compounds that are insoluble in water and soluble in non-polar solvents.…
Q: Which of the following statements concerning structural characteristics of bile acids is CORRECT? *…
A: Bile acids are a collection of acidic steroid molecular entities with unusual physical, chemical,…
Q: I. Identify the D,L convention of the following monosaccharides CHOV HOSIT H -OH H- -OH HOH -OH 196…
A: a: L-Altrose b: D-Allose c: D-Mannose For identifying the convention of D and L, the structure…
Q: Which of the following statements about monosaccharides is true? A. Monosaccharides are classified…
A: Monosaccharides are classified according to the location of their carbonyl group as wells as the…
Q: Identify (1) the group where the lipid belongs, and (2) determine whether the lipid is saponifiable…
A: Lipids are important fats that serve different roles in the human body,
Examples are provided, thank you
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- GRA H-C-OH C=0 HO-C-H H-C-OH H-C-OH H-C-OH CH₂OH H HH HO Select the correct molecule for each of the following questions. You may use each OH H H OH -CH₂ 0-P-0- 0 40 40 EEEEEEEEEE CCCCCCCCCCE AXCCCCCES voor m dPart C The L isomer of H-C-OH H-C-OH H-C-OH О CHO О О О CH₂OH OH OH OH OH OH Submit OH ОН OH O OH OH O. OH OH OH O OH OH OH OH OH OH OH Request Answerre aftached in a chain made rA phuephate andr A ba kleane made ef amine and eerboed gipe bee side dine iw fuckhemes ERnEEted ty hase pairs form a desle hdir. hree carboaviie neide are attached in a dyce molesale. the word(s) that best completes the statement 13. A fat that contains omly single bonds is atn) 2 fat. 14. The type of reaction that involves a single ouletaance breaking down into two Or more other substances is alu)2 seaction. 15. The energy carrier of the cell is the compound named 2 L 16. A reaction that can occur without continuing outside help is said to be 2 17. The relationship between the mass before and after a chemical reaction is described by the ? 18. Because it can proceed in either direction, the reaction between hydrogen gas and iodine gas is said to be ?. 19. An electrochemical cell that generates electricity using substances that are continually replenished from an outside source is a(n) ? cell.
- What is the sequence of the protein that would be translated from the following mRNA molecule? Use the single letter amino acid abbreviation for your answer. 5'- UGAUGUACCUCGCCUCUACGACGGAAUCCACA - 3'9) Label highlighted nerve in the box 10) This nerve belongs to the plexus.7. H 'C" 1 H-C -OH 1 H - C - OH 1 H COH 1 8. H H 9. H -C-C-H 1 OH H I 1 OH : H-D-E Chemical formula: Carbohydrak? Chemical formula: H 애 C XIX 애 CH ₂0H Carbohydrate? H Chemical formula OH Carbohydrate?
- _______ groups are the acid part of amino acids and fatty acids. a. Hydroxyl (OH) b. Carboxyl (COOH) c. Methyl (CH3) d. Phosphate (PO4)Plants often produce waxes on the surface of their leaves toprevent dehydration and protect against insects. What structural feature of waxes makes them more suitable for this taskthan carbohydrates or proteins?tue 16. Identify the molecule below H H H-N-C- C ОН CO ovo -CIR
- Which of the following is achiral amino acid coo cooe H,N-C-H CH3 H,N-C-H HO ÇH, OH CH3 но H. HN- NH2 NH2 E D O A C O E овThe sugar molecule shown below is the cyclic form of a/an___________and the anomeric carbon is in the position. HO-CH, H H OH O ketopentose; B O ketohexose; B O aldopentose; & H/OH OH H ketopentose; xSphingolipids can contain of all of the following except O Glycerol O more than one choice O phosphate O a mono- or oligosaccharide O sphingosine.