) how many turns are in this alpha-helix? Should be an integer b) length in angstroms?
Q: %20₂ + H+ ⇒ NAD+ + H₂O This is the overall reaction for t Oxidative decarboxylation c Glycolysis…
A: The NADH in presence of electron acceptor oxygen converts into NAD+ and ultimately produces water…
Q: What is a characteristic of an amino acid, which is ketogenic but not glucogenic? The amino acid can…
A: A ketogenic amino acid is one that may be metabolized directly into acetyl-CoA, a precursor to…
Q: What are the reasons why most of the clinical features of the diseases Fumarase deficiency and…
A: Introduction: Fumarase deficiency which is also known as fumaric aciduria is a rare autosomal…
Q: Given the Ramachandran Plot below, identify the protein components that could adopt the phi-psi…
A: Ramchandran plot is a two dimensional plot used to visualize energetically allowed regions for…
Q: Which is the odd one out ? For the rest, explain the concept/process/technique they are involved…
A: The central dogma is a framework for understanding the transfer of information between informational…
Q: 1. ATP ACCOUNTING Provide what is being asked for. Show all relevant calculations and summarize your…
A: Beta Oxidation is the process to break down fatty acid. This process takes place in mitochondria (in…
Q: ANDOKOLESTEROL 13 14 15 16 << 13 14 15 To unde 20 PLCAT 18 16 A. Chylomicrons remnants B. IDL CapoB…
A: Introduction: Lipoproteins are spherical molecular complexes that contain both lipids and proteins…
Q: 1.0 0 0.5 0 5 Ligand A Ligand B 10 15 20 25 Ligand Ligand D 40 45 50 55 60 30 35 [Ligand] (MM)
A: Kd is dissociation constant which is ligand concentration at half of saturation or at 0.5 theta…
Q: ou are subsequently instructed to improve the biochemical function of pyruvate kinase, which aids in…
A: Pyruvate kinase is an enzyme that regulates cell metabolism by catalysing the conversion of…
Q: نقطة واحدة * intrinsic factor is serected by intrinsic factor Parietal cells ΟΟΟ Chief cells O G…
A: Structure of Intrinsic factor: Genuine Cbl is identified by an inherent component detected in…
Q: Do you think globalization affects the environment? Why or why not? Support your answer with…
A: Globalization is a process in which people of different countries or continents are interacting with…
Q: What do COX enzymes synthesise?
A: Arachidonic acid acts as the precursor of the molecules known as eicosanoids. There are two pathways…
Q: A glucogenic amino acid is defined as an amino acid that can be produced from glucose catabolism O…
A: Depending upon the process of degradation of amino acid, they can be classified into 2 categories:…
Q: I. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A: Beta oxidation is the oxidative catabolism of fatty acid where fatty acid is converted to acetyl CoA…
Q: What is the role of tyrosine in prostaglandin synthesis? Tyrosine provides the proton to the double…
A: Prostaglandins are mostly produced from Arachidonic acids( a C20 poly-unsaturated fatty acids) in…
Q: Place the steps in the propagation of nerve impulses in the correct order.
A: Introduction: Nerve impulse is also called as "ACTION POTENTIAL". Action potential can be defined…
Q: The citric acid cycle is mainly controlled at the first two NADH-producing reactions catalyzed by…
A: Citric acid cycle is the second stage of cellular respiration during which Acetyl CoA is reduced to…
Q: Our body can get pentoses from * O (A) Glycolytic pathway O (B) Uromic acid pathway O (C) TCA cycle…
A:
Q: Draw the complete structure of the trinucleotide deoxyribo-oligonucleotide that is complementary to…
A: Nucleotides are building block of DNA and RNA. The given nucleotide chain is 5'dTdGdA3'.
Q: Arachidonic acid (omega-6 20:4) is an essential fatty acid O True O False
A: Animals cannot synthesize certain fatty acids & in order to survive such fatty acids must be…
Q: 7. cis 20:5(45,8,11,14,17) 20:5;5,8,11,14,17 w3,6,9,12,15 8. trans 20:5(45,8,11,14,17)…
A: Cis and trans Fatty differ in the arrangement of hydrogen atoms on the double bonded Carbon atom.…
Q: Write notes on the following topics: 1- Structure and function for adipic acid and suberic acid 2-…
A: "Since you have posted a question with multiple subparts, we will solve first three subparts for…
Q: For effective metabolic pathway regulation, a(an) ______ binds to the enzyme catalyzing the first…
A: Enzyme acts as catalyst in various metabolic reaction which takes place in our body.
Q: Question #5 5A. Draw a triglyceride with one polyunsaturated fatty acid acid (12 carbons), one…
A: Lipid are actually the cellular components that form insoluble part of cell having large diversity…
Q: ___________ is considered an important amphibolic pathway which plays a major role in oxidative…
A: Amphibolic pathway meaning that they can perform both catabolic(breakdown) and anabolic(synthesis)…
Q: Bilirubin is conjugated in the hepatocytes to * O Gluconic acid O Glucuronic acid O Glucaric acid O…
A: Bilirubin comes from two different sources. Approximately 80% of bilirubin is produced by the…
Q: ALL biosynthetic reactions require which of the following metabolites(s)? NADPH Glucose 6-P High…
A: Biosynthetic reaction is the process in which products are formed from simpler building blocks.
Q: Regulation of fatty acid metabolism is shown by the following strategies. Which statement is NOT…
A: Fatty acids are important component of the body, they serve as energy reserves of the body and help…
Q: An increase in blood levels of which of the following increase the risk for atherosclerosis?…
A: Every cell in the body needs cholesterol to form cell membrane layers. These layers protect the…
Q: 26. Which of the following amino acids can enter directly into the citric acid cycle intermediates?…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. C…
A: If we represent the nitrogen base as a triangle, there are going to be three edges: Hoogstein Edge:…
Q: The peptide segment shown below is part of a right-handed alpha helix. Please indicate the…
A: Alpha helixes are regular secondary structures. The hydrogen bonding pattern of an alpha helix is,…
Q: ENZYME/PATHWAY 1. phosphofructokinase-1 2. pyruvate dehydrogenase complex 3. Krebs cycle 4. lactic…
A: Introduction Phosphofructokinase 1(PFK1)is a kinase enzyme that phosphorylates fructose…
Q: Type Il diabetes is best described as the long term effects of immune attack of the pancreatic beta…
A: Type II Diabetes is a chronic condition in which the body does not produce enough insulin as per the…
Q: Question # 2 The Km of an enzyme is 5.0 mM. 2A Calculate the substrate concentration when this…
A: Kinetics is the scientific discipline that studies reaction rates. Enzyme kinetics investigates the…
Q: In biochemistry, the term “Pi” is used as a shorthand for: the inorganic phosphate ion in any of…
A: Phosphorus and phosphate are present inside the cell. It helps in the phosphorylation of many…
Q: Which of the following factors is responsible for the denaturation of proteins? * Oa) Heat Ob)…
A: Denaturation of any protein includes a number of weak bonds or weak linkages, that occur within a…
Q: 3. A 45-year-old woman was admitted to hospital because of frequent headaches, muscle weakness,…
A: Adrenal glands are the glands located above the kidneys. The adrenal glands have two regions known…
Q: Match lipid descriptions in column A with the phospholipid type in column B ✓ H is attached to the…
A: Membrane is composed of phospholipids whose structure has polar head group & non-polar tails.…
Q: Which enzyme catalyzes the conversion of Cholesteryl ester to cholesterol and fatty acid?…
A: Cholesteryl ester is a dietary lipid that is an ester of cholesterol. The carboxylate group of fatty…
Q: 11D The T-state structure of hemoglobin is an example of a whereas its alpha helices are an example…
A: Introduction: Hemoglobin is a respiratory pigment found in red blood corpuscles. It is made up of…
Q: How does PFGE separate larger fragments more efficiently than standard electrophoresis? 2. Why is…
A: Gel electrophoresis is a analytical method for characterization of DNA and RNA and the visualization…
Q: A. Consider the following fatty acids and the given cellular condition/location. Ï. 24:1A fatty acid…
A: β-oxidation of unsaturated fatty acid undergoes the same process as saturated fatty acid until the…
Q: 01110 0= -P-OCH₂ 51 5 HN 6 OH 3. CH₂
A: DNA is composed of deoxyribose nucleotides attached together via phosphodiester bonds. RNA is…
Q: What do COX enzymes synthesise
A: COX : Cyclooxygenase or Prostaglandine endoperoxide synthase , It is a bifunctional enzyme produce…
Q: A. You have 3% (w/v) concentrated saline in 20 mL ampoules. What volume and how many ampoules do you…
A: Introduction: The concentration of a solution is a measure of the amount of solute present in a…
Q: Many common household cleaners, such as stain removers, are based on the use of polar and non-polar…
A: Household cleaners are basically used to clean the stain and dirt. Non-polar is generally dissolved…
Q: State whether the gene is up- or down-regulated and briefly explain the reason behind. DNA lacks…
A: Genes are composed of nucleotide bases present in the genetic DNA. A genome is a double-stranded DNA…
Q: Define what a hydrogen bond is and illustrate how two peptide bonds can be hydrogen-bonded to each…
A: Water molecules, DNA double-strand bindings, proteins, and other molecules all contain hydrogen…
Q: Two amino acids of the standard 20 contain sulfur atoms. They are: a. cysteine and serine. b.…
A: Introduction: An amino acid is a compound that contains an amino group, a carboxyl group, and a…
a) how many turns are in this alpha-helix? Should be an integer
b) length in angstroms?
Step by step
Solved in 2 steps
- Dihydrid Cross14 C fill the blank with correct answerHindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)