How many peptide bonds were produced by creating the followingHow many H2O particle were produced by creating the followingstructure if the starting reagent is glucose? *structure if the starting reagent is glucose? *CH,OHCH,OHCH,OHCH;OHCH;OHCH;OHOHононOH250 ÓHOHOHÓHOHOH300А.) 125B.) 250А.) 30c.) 25B.) 301D.) 500C.) 302E.) OD.) 300E.) 150F.) O

Introduction: Amino acids are joined together by a condensation reaction between carboxylic and…

Answered: How many H2O particle were produced by…

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter9: Parenteral Medication Labels And Dosage Calculation

Section: Chapter Questions

Problem 6.7P

See similar textbooks

Similar questions

A) Refer to the figure below, Identify and explain the two types of reactions, and describe what are the importance of these reactions to our bodies. Reaction 1 H Monomer Reaction 2 H H OH + H H H₂O H H₂O OH + H H OH OH + H H₂O H₂O OH OH + H OH OH OH OH B) What are the main chemical interactions that determine and maintain the quaternary structure of proteins. Also, what are the conditions that can alter these interactions? [
How many H2O particle were produced by creating the following structure if the starting reagent is glucose? * CH,OH CH,OH CH,OH OH OH OH ÓH ÓH 300 O A.) 30 О в ) 301 О с) 302 O D.) 300 O E.) 150 O F.) O
a) A solution of amino acid having carboxylic side chain was titrated against NaOH. If initial pH of the solution was 2.8. Describe the state of the functional groups of the amino acid at the initial pH and at 10.5.b) Briefly explain how you will separate amino acids mixture using the charge difference between the amino acids.
(a) Draw the structure of ninhydrin. (b)Write the complete equation for its reaction with amino acids. (c) What is the substance responsible for the purple colour produced upon reaction of ninhydrin with an amino acid?
1)Ubiquitin is a small protein with a monoisotopic mass of 8560 Da. a) Electrospray ionization of this small protein typically results in major charge states of +8, +9, +10, +11, +12, and +13. Using this information, complete the table below, assuming the charges on each come from protonation. Report mass and m/z values to the ones place. b) Using the data you entered in the table, sketch an expected ESI-MS spectrum for ubiquitin. Label each peak with its charge state. What do you notice about the spacing of peaks along the x-axis. c)The figure shows an experimentally obtained electrospray mass spectrum for ubiquitin. Compare this spectrum to the spectrum you predicted. Are there any differences? If so, what might cause these differences?
Select the term in column B which best matches the description in column A. There are more terms then needed. Column A Column B 1. The pentose sugar found in DNA. a) Cis fatty acid b) Trans fatty acid c) Coenzyme d) Cofacipr 2. Commonly referred to as "insoluble fiber". 3. Considered to be an amphipathic molecule. 4. A molecule with the formula C18H3602 is probably a e) Phospholipid 5. Bond created during the formation of the primary structure of a protein. ) Glycogen 6. A non-protein organic molecule needed for proper enzyme functioning. g) Cellulose 7. Pyrimidine base found only in RNA. h) Galactose i) Fructose 8. Increasing the number of these molecules in the cell membrane would increase the permeability of the cell membrane. i) Thymine k) Uracil 9. Bond which connects nucleotide monomers together. 1) Fatty acid m) Disaccharide n) Peptide bond o) A-Helix p) B-Pleated Sheet q) Ribose r) Deoxyribose 10.
You are studying the tripep de Lys-Val-Thr. a) Could you use the absorbance at 280 nm to determine the concentra on of this tripep de? Briefly explain your answer. b) Show how the charge of this pep de would change at different pHs.
An octapeptide was hydrolyzed and the amino acids separated. Its amino acid composition was determined: Gly (1); Ala (2); Val (1); Lys (2); Met (1); Asp (1). After incubation with FDNB and hydrolysis, 2,4-dinitrophenylalanine was detected. NO, H N -C- COOH H O,N CH, Treatment with cyanogen bromide, which cleaves at M, resulted in two fragments: a pentapeptide containing two K residues and a tripeptide containing V, G, and A. The residues are not listed in any particular order. After treatment with trypsin, which cleaves at R and K, there were three fragments: two dipeptides and MGAV. What is the sequence of the octapeptide? Use the one-letter abbreviations for the amino acids, and do not use dashes. octapeptide sequence:
Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram.C) Show/Indicate the type of linkages per structure (put an arrow). 4) Sphingolipid/Sphingophospholipid (use sphingosine, myristic acid, phosphate, and choline for amino alcohol);
Cysteine is converted to cystine which is readily transported into mammalian cells. In the cells, cystine is converted back to cysteine, an essential amino acid needed to synthesize biomolecules such as proteins, or Coenzyme A3. What reagents would you choose to make the disulfide bond in the lab? Choose all that would produce the disulfide bond.
What is the melting temperature and G/C content of the following primers? a.) 5’ GAAATAATTTTGTTTAACTTTAAG 3’ b.) 5’ GTAACTCAGCTTTCAGGTCG 3’
b) Determine which ionization state corresponds to aspartic acid (shown below) at pH 1, 7, and 10 by selecting the most suitable answer from the statements i-iv. The pK of the amine, carboxylic acid, and side chain of aspartic acid are 9.6, 1.88 and 3.65, respectively. ОН ÓH ÑH2 i) the amine is charged; the carboxylic acids are neutral. ii) the amine and carboxylic acids are all charged. iii) the amine is neutral, and the carboxylic acids are charged. iv) the amine and the carboxylic acids are all neutral. pH Statement (i, ii, iii, or iv) 1 7 10 %3D

SEE MORE QUESTIONS

Recommended textbooks for you

Curren'S Math For Meds: Dosages & Sol

Nursing

ISBN:

9781305143531

Author:

CURREN

Publisher:

Cengage

Curren'S Math For Meds: Dosages & Sol

Nursing

ISBN:

9781305143531

Author:

CURREN

Publisher:

Cengage

SEE MORE TEXTBOOKS