How many ATP are made in the electron transport chain if Suzy ate 100 molecules of glucose?

Q: 50. A 23-year-old man is brought to the emergency department 1 hour after being injured in a hunting…

A: The brain is a complex organ that regulates every process in our body, including thought, memory,…

Q: Chimpanzees and humans obviously look and act very differently, but their genomes are remarkably…

A: Chimpanzees and humans obviously look and act very differently, but their genomes are remarkably…

Q: The mitral valve is located between the

A: The mitral valve or bicuspid valve is located between the left atrium and left ventricle.

Q: Fats, cholesterol and waxes are examples of which type of biomolecules? * A. Carbohydrates B.…

A: Biomolecules are chemical compounds found in living organisms. These include carbohydrates, lipids,…

Q: Use the following figure to answer the question. юдо TO The pedigree in the figure shows the…

A: A pedigree chart is a graphic which depicts the incidence and emergence of phenotypes of a specific…

Q: Choose the incorrect option regarding protein motifs They lose their structure after breaking away…

A: Introduction Proteins are macromolecules made up of one or more long chains of amino acid residues.…

Q: 3⁰ A 5 A GC G G A UA A/C UGU P Examine the tRNA above. Which codon on the mRNA strand codes for this…

A: The translation is the process by which polypeptide chain or protein is synthesized from the mRNA…

Q: What causes the transfer of electrons through an electron transport chain?  a. The initial "push"…

A: Introduction The electron transport chain is a collection of proteins and organic compounds located…

Q: You touch a hot stove and withdraw your hand before you perceive the pain. Identify the neural…

A: Introduction NEURAL PATHWAY:- A series of connected nerves along which electrical impulses travel in…

Q: Who originally deserved Kudos for genetic engineering

A: Genetic engineering, often known as genetic modification or genetic manipulation, is the use of…

Q: A)Name the vertebra seen here. [this vertebra has a special name] B)What is the name of the foramen…

A: The bones of The skeleton which form the main longitudinal axis of the body in human and other…

Q: When an inhibitory neurotransmitter such as GABA opens cl– channels in the plasma membrane of a…

A: Introduction :- Inhibitory neurotransmitters hinder the chemical communication from being…

Q: In reference to the following table:  F1 ebony flies - 0  F1 non-ebony flies - 560  F1 stubbly…

A: Inheritance is the foundation upon which heredity is built. It is described as the process through…

Q: The best example of a population in the list below is the     a tiger salamander tadpoles in 2006.…

A: A population comprises individuals of the same species. Population of different species together…

Q: Create a metabolic pathway map that includes "the 4 Gs": glycolysis, gluconeogenesis, glycogen…

A: Glycolysis is The process by which glucose is converted into pyruvate. Gluconeogenesis is the…

Q: Which Omics techniques is known as environmental genomics or community genomics? Write advantage and…

A: The structure and function of complete nucleotide sequences isolated and analysed from all of the…

Q: how the animals and plants of a healthy ecosystem are organized and interact.

A: Introduction : The natural connectivity between animals, plants, and their environment is referred…

Q: where the three pl G Free Printable De... Female gametophyte Egg Male gametophyte Sperm. Zygote…

A: Plant Kingdom is a kingdom which comprises of photosynthetic , autotrophic organism that is plants .…

Q: LO B A

A: Introduction  The heart is a muscular organ that pumps blood. The heart pumps blood throughout the…

Q: please DEFINE your genotypic symbols, then list the most probable genotype of each of the…

A: 1)Black shaded square shows :- male with trait (affected males). Black shaded circle shows :- Female…

Q: In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the…

A: CRISPR is a DNA sequence that found in prokaryotic organism's genome like bacteria , archaea.…

Q: Match the appropriate tems to their definitions TCAcyclo tricarboxylic and Choose cycle 4 Choose the…

A:

Q: Explain why the study of the human body can beoverwhelming

A: Introduction  Humans are the most common and widely distributed primate species, with bipedalism and…

Q: How would a scientist, observing a prokaryote and a eukaryote replicating their DNA, be able to…

A: There are broadly two types of cells based on the structure and function, prokaryotic cells( form…

Q: How does DNA profiling make use of genetic variation in DNA sequences

A: DNA profiling is also called DNA fingerprinting.

Q: Which of the following types of neurons are indicated by asterisks in the photograph of a cross…

A: The nervous system is the most vital system in the human body. It comprises of the neurons which are…

Q: The following question refers to the pedigree chart in the figure for a family, some of whose…

A: It's given that the trait W is dominant which means this trait can express in homozygous condition…

Q: A 50-year-old woman has diminished vibratory sensation on her right arm. Which of the following…

A: The brain and the spinal cord are the two main organs of the central nervous system. Spinal cord…

Q: Compare and contrast monogamy, polygyny, polyandry, and promiscuity? Provide examples. Monogamy is…

A: Mating system classification provides qualitative insight into the overall mating dynamics that…

Q: 86. A newly discovered infectious agent is found to have genetic material with the following base…

A: Given base composition of the newly discovered infectious agent -  Adenine - 23% Cytosine - 26%…

Q: ake the example of B-thalassemia, an autosomal recessive genetic disease that particularly affects…

A: A point mutation is a change in the single nucleotide pair of DNA.

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Match the term in column A with its description in column B.

A: KIR stands for Killer cell immunoglobulin-like receptors (KIR), family of highly polymorphic…

Q: If a cell were damaged, & DNA ligase could no longer be produced, how would replication be affected?

A: Each strand of DNA participates in DNA synthesis due to its double helix structure. DNA synthesis is…

Q: Which of the following statements is false?a. Auxin and gibberellin promote stem elongation.b.…

A: Introduction :- Abscisic acid (ABA) is a major hormone involved in tuning responses to a variety of…

Q: Write advantage and drawbacks of RISA (Ribosomal Intergenic Spacer Analysis) technique. What is the…

A: RISA is the technique for microbial community analysis. It helps in determining the species…

Q: Plant-based foods such as fresh fruits, vegetables, legumes, and whole grains and vegetarian eating…

A: d all of these  Plant based diet can improve gut health in about 5  days . Legumes , Vegetables are…

Q: 19. Which class of carbohydrates consist of two monosaccharides that are covalently bond with one…

A: Carbohydrates, also known as sugar molecules, are sugar molecules. Carbohydrates are one of three…

Q: A)Identify the bone B)What is the name given to area the arrow points to. C) Name one joint this…

A: The arms are the part of the skeleton, which include the bones of upper arm, firearm, wrist joints,…

Q: The coats of Labrador retrievers are black, chocolate, or yellow in colour. Two genes control coat…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: The nucleotides from a bacterial cell were found to have the following abundances: 39% uracil; 41%…

A: Nucleic acid : these are macromolecules that gives genetic information and enables protein…

Q: To describe the six main taxonomic groups of fungi and also explain the reason that some fungal…

A: As per our company guideline we are supposed to answer only first question. Kindly repost other…

Q: The reason that why mycorrhizae might have been important in the colonization of terrestrial…

A: Mycorrhizae is generally defined that they are been a symbiotic relationship between fungi and plant…

Q: Answer whether the following statement is True or False: Diameter of nascent polypeptide exit tunnel…

A: Introduction: Peptide bonds are formed when amino acids are condensed to form protein structures. A…

Q: Identify the incorrect statement regarding NKT cells. (Select all that apply.) a. They express α:β…

A: NK cells play an important role in the innate immune response to primary infection, as well as…

Q: S1 heart sounds (“lub”) represent the closing of the

A: Heart is the main pumping orgen of circulatory system and vital organ of body. Contraction and…

Q: Pollen grains are derived from a microsporocyte, developed inside the microsporangia of an anthe and…

A: Flowering plants are known as angiosperms. The reproductive organ of angiosperms is the flower.…

Q: In which parent and during which meiotic division did non-disjunction occur? If there is more than…

A:

Q: A highly talented 22-year-old female college athlete has just qualified to compete in the Summer…

A: Complete androgen insensitivity syndrome occurs when the body cannot use androgens at all. People…

Q: RNA has many functions in a cell. Besides mRNA, which carries information from the genome to the…

A: RNA is a nucleic acid which is present in all living cells. It has structural similarities to DNA…