How could this result in the evolution of drug-resistant pathogens? Rank the steps from first to last. To rank items as equivalent, overlap them. Treatment discontinues while bacteria are still present First step Bacteria survive without the inhibiting effects of drugs Resistant strains stay alive Antibiotic therapy is restarted Nonresistant straing get eliminated Reset Help The Bacterial population rebounds and deease symptoms return Last step
Q: Which of the following is NOT true for the speciation of finches in the Galapagos islands? A.…
A: Analyzing Statements about the Speciation of Galapagos Finches:The statement that is NOT true about…
Q: what does it mean to say that trends in a double helix is antiparallel? A. They each have a…
A: In the context of genomics, the word "double helix" refers to the physical makeup of DNA. Two…
Q: Provide details about the reation workup. How is this product purified , and what methods were used…
A: The objective of the question is to understand the process of reaction workup, purification, and…
Q: A surgical pathology specimen from a 24-year-old woman seen at a reproductive medicine clinic…
A: The question is asking to identify the location in the female genital tract from which a biopsy was…
Q: In Drosophila, the gene w specifies eye color. Wildtype allele w+ gives red eyes and is dom…
A: In the fruit fly Drosophila melanogaster, eye color and wing size are determined by two genes…
Q: Which enzyme starts at an RNA primer and elongates the new DNA strand? DNA primase…
A: The objective of the question is to identify the enzyme that starts at an RNA primer and elongates…
Q: Researchers want to determine if a single locus has a large effect on the color of the throat…
A: In genetics, a locus (plural loci) is a specific, fixed position on a chromosome where a specific…
Q: In roses, purple flower color is determined by the dominant P allele, while pp homozygotes are…
A: We're dealing with a test cross in roses, where we're uncertain about the genotype of one plant. The…
Q: Which of Aristotle’s four causes is a definition of the physical force which exerts an effect? the…
A: The objective of the question is to identify which of Aristotle's four causes corresponds to the…
Q: what is background extinction rate
A: The objective of the question is to understand the concept of background extinction rate in biology.
Q: The salamanders of the genus Ambystoma in northeastern North America are an entirely female…
A: The salamanders of the genus Ambystoma in the northeastern North America are an interesting example…
Q: 26. On the photo below circle and label the cell of origin for each of the four subtypes of leukemia…
A: Leukaemia is the cancer of white blood cells. In leukemia there is an uncontrolled division of…
Q: Which of the following arithmetical series contains only prime numbers (with no composites)? 1, 4,…
A: The objective of the question is to identify the series that contains only prime numbers. A prime…
Q: Polar bears are considered solitary species—animals that spend most of their lives on their own.…
A: The question is asking for a reason why polar bears, which are typically solitary animals, might…
Q: ㅂ 분 20 4 3 2 U Bronchoalveolar lavage fluid obtained from a 34-year-old healthy volunteer is found…
A: The objective of the question is to identify the source of the enzyme elastase in bronchoalveolar…
Q: How might virus infection lead to increase energy production in the cell? Group of answer choices…
A: The objective of the question is to understand how a virus infection can lead to increased energy…
Q: How can I structure an informational public service announcement regarding childhood vaccination,…
A: Introduction :• Start with a compelling statistic: “Did you know that childhood vaccinations prevent…
Q: Question 1: While examining a gene related to calcium ion channels in humans (CACNA1S) you discover…
A: D IS THE CORRECT ANSWER. AND EXPLANATION IS GIVEN BELOW .Explanation:
Q: Examine the following theoretical operon (gen) in E. coli which contains structural genes (genC,…
A: Question 6 - Gain of Function:A base substitution mutation in the operon could result in an altered…
Q: Discuss the intradermal route: Explain that intradermal vaccines are injected just below the skin's…
A: The intradermal route of vaccine administration involves injecting vaccines just below the skin's…
Q: The geocentric model of our solar system was favored by all of the following investigators except:…
A: The objective of the question is to identify the investigator who did not favor the geocentric model…
Q: Mention one safety precaution that should be taken during experiment
A: It is a test that is usually done to identify the level of starch in a leaf.
Q: Why would the nucleotide bases be represented as puzzle pieces, as in the illustration below? What…
A: The nucleotide bases in DNA are the basic units of hereditary code and their interaction is basic to…
Q: Which of the following is NOT an example of evolution? Group of answer choices Increased wealth in…
A: Evolution is a essential concept in biology that clarifies how species alter over time through the…
Q: Can someone explain why those values were chosen to be divided by the total? I thought it was the…
A: Recombination frequency refers to the probability that two linked genes will be separated during…
Q: How can Prokaryotic cells be smaller than Eukaryotic cells and still carry on all the functions of…
A: The size difference between prokaryotic and eukaryotic cells is a significant characteristic in…
Q: Cytochrome bf releases how many H* into the lumen for each QH₂ molecule cycle? four one two three
A: A class of heme-containing proteins called cytochromes is present in all cells and is essential for…
Q: A medical student is studying a liver biopsy taken from a regenerating liver following a partial…
A: The objective of the question is to identify the correct description of the chromosomes in a…
Q: Define density-dependent and also define density-independent mortality factors, and give one…
A: The objective of the question is to define density-dependent and density-independent mortality…
Q: Order of transmission First Last Hfr strain 2 3 D L C M E D M 1 MUURB K L E K C U R C B MOD K U 4 M…
A: Given:Four Hfr strains were tested for the sequence in which they transmitted genes to an F…
Q: 2. Achondroplasia is a form of dwarfism caused by a dominant allele. The homozygous dominant…
A: The objective of this question is to understand the inheritance pattern of achondroplasia, a form of…
Q: Populations of organisms can be found as clumps, randomly dispersed, or uniformly dispersed.…
A: The objective of the question is to classify the dispersion patterns of different organisms in their…
Q: In alley cats, the coat color is determined by a gene carried on the X-chromosome. At the same time,…
A: The objective of the question is to determine the probable paternity of a litter of kittens based on…
Q: Which of the statements is FALSE?
A: We must have prior knowledge of the following areas in order to comprehend each statement in the…
Q: How to I calculate # species Canada and % Total for the IUCN table? Under the redlist catagory the…
A: Red Rundown Class Outline:CR (Basically Jeopardized), EN (Imperiled), VU (Defenseless).Marks species…
Q: Which of the following are NOT potential consequences of the loss of genetic variability for tiger…
A: Genetic variability is the difference in the genetic makeup (difference of genes) in the organisms.…
Q: 2. A tall (dominant) pea plant is under consideration for a genetic experiment. What is the best…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: The blood analysis of a typical environmental consultant that carries out fieldwork might contain an…
A: One persistent organic pollutant (POP) that could potentially be found in the blood analysis of an…
Q: In cattle, the character lack of horns is dominant (C) to the presence of horns. Our bull mates with…
A: Genotype refers to the genetic makeup of an organism, typically represented by the combination of…
Q: What is the role of gp120 in HIV infection?
A: The virus known as HIV (human immunodeficiency virus) targets the immune system of the body. HIV can…
Q: Choose all that apply. We sample a population and genotype 2 loci on 100 chromosomes. We find the…
A: A chromosome is a thread-like structure made of linked proteins and DNA that is located in the…
Q: Assume a deletion occurs in a gene that encodes DNA polymerase I and no functional DNA polymerase I…
A: The objective of the question is to understand the role of DNA polymerase I in DNA replication and…
Q: Explain the difference between generalized and specialized characteristics. What are examples of…
A: Generalized and specialized characteristics refer to two contrasting strategies that organisms…
Q: A blood-alcohol content (BAC) level of milliliters of blood is considered legally intoxicated. O .04…
A: For legal or medical reasons, blood alcohol content—also known as blood alcohol concentration or…
Q: A 22-year-old man is brought to the emergency department in respiratory distress 15 minutes after he…
A: The case study details a 22-year-old man who was stung by a wasp and developed an allergic reaction…
Q: Which of the following muscle cell components helps spread the depolarization of the muscle cell…
A: The objective of the question is to identify the muscle cell component that is responsible for…
Q: Snipping Tool New L ADAL Q Q- Q At which of the following sites is the characteristic triple helical…
A: The question is asking about the location within a cell where the triple helical structure of…
Q: Viruses encode many ways to antagonize the Pkr pathway. Which is not a direct target of viral Pkr…
A: The question is asking us to identify which among the given options is not a direct target of viral…
Q: 18. Malabsorption of B vitamins is common in patients with untreated celiac disease. Of which type…
A: Patients with untreated celiac disease are most at risk for a type of anemia known as:C) Pernicious…
Q: Why are chronic leukemias less aggressive than acute leukemias?
A: Chronic leukemia is not a sudden onset it has slow progression process. Here the blood cell…
Give correct typing answer
Trending now
This is a popular solution!
Step by step
Solved in 1 steps
- This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acidsBecause of overuse of antibiotics and/or weakened governmental surveillance of infectious disease, several diseasesthat had been thought to be no longer a threat to humanhealth (e.g., pneumonia and tuberculosis) are rapidly becoming unmanageable. In several instances, so-called superbugs(microorganisms that are resistant to almost all known antibiotics) have been detected. How did this circumstancearise? What will happen if this process continues?go to the website https://www.nature.com/immersive/d42859-019-00041-z/index.html and scroll up and down to review the milestones associated with microbiota research. Answer the questions/ prompts below. Bacteria and our brain? Read the information associated with this milestone and what was discovered. Briefly describe what they found...Milestone/year? What milestone is associated with the debate about when the microbiome is first established? Why is there a debate? Watch the video just below the milestone. What specific type of gene analysis was used to determine that we have our own unique microbiome? Which milestone/year? Sometimes we need antibiotics...this milestone discusses how long it can affect us after infection. In this milestone they discussed how long we could be affected by one course of antibiotics...how long? Which milestone/year? Find the milestone associated with a highly motile bacteria. What disease was treated? How was this treatment used for a…
- Which of the following is NOT true about Koch's postulates? First developed by Robert Koch, the pioneering German microbiologist In the first step, the microbe that causes a naturally occurring disease is cultured from a "wild" (non-laboratory) animal which has that disease None of the other four answers (All are true about Koch's Postulates) They represent a process for showing a causal association between a specific microbe and a disease If the same microbe from a diseased "wild" (non-laboratory) host causes the same disease in a lab animal and it can be cultured from that lab animal, this proves that the microbe is the cause of the naturally occurring diseaseThe following graph shows the trends in bacteria and viruses after they infect an organism. A B Time Time 02017 Panon Eacatn, ine. Part A: Explain how reproductive differences between these two pathogens attribute to the differences shown in the graph. Identify whether viruses are organisms and describe how this graph supports your claim. Part B: Most antibiotics target the cell wall of a pathogen. Use the graph to explain why antibiotics can be ineffective against some pathogens. Number of bacteria- Number of viruses →I dont understand this practice Biology Question. In order to categorize bacteria, scientists use various characteristics to classify them into groups. Without naming these groups, explain characteristics and tests used by microbiologists to assign bacteria to different taxonomic groups.
- What is the best explanation for why a bacteriostatic treatment might be chosen over a bacteriocidal treatment? Bacteriostatic treatments will eliminate all bacteria while bacteriocidal treatments will only eliminate a portion of the bacteria. Bacteriostatic treatments typically have lower toxicity to the host when compared to bacteriocidal treatments. Bacteriostatic treatments will prevent all bacterial growth, while bacteriocidal treatments will permit some bacterial growth. Bacteriostatic treatments are typically more costly than bacteriocidal treatments.Name two or more situations where Koch’s postulates are impossible to complete? In other words, what factors about a microbe or factors about a disease make it impossible for Koch's postulate to be performed with that microbe or disease?Defend or refute thisstatement: Microbes intendto cause human disease.
- In a series of infection experiments, a researcher discovers that the ID50 value for the infectious bacterium Parasiticum mucoides is 100, and that the ID50 for another infectious bacterium, Donoteatum thisbacterium, is 15,000. Given these data, a person exposed to 1,000 bacteria of each type would be more likely to be infected by which bacterium? Group of answer choices There is no way to know given the information provided Both infections are equally likely Parasiticum mucoides Donoteatum thisbacteriumWhich of these statements is false? Microbiology is one of the largest and most complex of the biological sciences O Microbiology is a specialized area of biology that deals with tiny life forms that are not readily observed without magnification. The major groups of microbes included in this field of study are bacteria, viruses, fungi, protozoa, algae, and helminths. Every single microbiologist works in a lab.Identifying an unknown bacterium is an essential step in the diagnosis and treatment process. Since not every antibiotic is effective against every type of bacteria, knowing what caused a particular infection allows us to make correct prescriptions so patients can recover more quickly. Knowing the cause of an infection also prevents antibiotic resistance as well, since incorrect prescriptions allow bacteria to be unnecessarily be exposed to antibiotics, increasing the chances of developing resistance.