Assuming the following commands are used in a program where the definition file m2560.def has beenincluded, what value being loaded into the designated registers? Assume R28 initially contains OXD3.SHOW ALL WORKLDI R16, HIGH(RAMEND)MOV R11,R16MOV R16,R28ASR R16ADC R16, R11MOV R29,R16STD Y+6, R16SEIR11=R28=R16=R29=Y=Provide the final values of the status flags after the final instruction (0, 1, or U for unknown)IHSV-Other than the general purposes registers, are any other sections of the memory map affected (changed)by this program? Yes/NoIf yes, what addressandwhat section of the ATmega2560 memory map

HOW ALL WORK LDI MOV R11,R16 MOV R16,R28 ASR R16 ADC R16, R11 MOV R29,R16 STD Y+6, R16 SEI R16, HIGH(RAMEND) R11- R28= R16= R29= Y= Provide the final values of the status flags after the final instruction (0, 1, or U for unknown) H V I

HOW ALL WORK LDI MOV R11,R16 MOV R16,R28 ASR R16 ADC R16, R11 MOV R29,R16 STD Y+6, R16 SEI R16, HIGH(RAMEND) R11- R28= R16= R29= Y= Provide the final values of the status flags after the final instruction (0, 1, or U for unknown) H V I

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Please write a c++ program that will take in a file, a number_of_bytes and number_of_threads. So it will take in 3 arguments in the command line. mmap the number_of_bytes of the given file into memory. The program will mmap 100 Megabyte of file into memory and use 4 threads to examine the bytes. The main will not participate in the computation, but will create the specified number of threads, and wait for them to complete the computation, and the main will then print the answer. At most 8 threads will be specified to be created. Each file will contain a long string of letters like DNA, i.e. a,c,g,t The program should determine how many 20-character substrings contain more than 11 a's. For example, in this string there are characters matches: tattataaagtagaaatataactgaaggttcagccgctggattataaagtagaaatataaaaagtagaaatataactgaa The program should output: total matches number # number is replaced by the correct number
Someone has modified the utils.asm file to insert a PrintTab subprogram immediatelyafter the PrintNewLine subprogram as shown below (changes are highlighted in yellow).The programmer complains that the PrintTab command cannot be called using the "jalPrintTab" instruction. What is wrong, and how can this be fixed? Explain all theproblems in the code this programmer has written.# subprogram: PrintNewLine# author: Charles Kann# purpose: to output a new line to the user console# input: None# output: None# side effects: A new line character is printed to the# user's console.textPrintNewLine: li $v0, 4 la $a0, __PNL_newline syscall jr $ra
Someone has modified the utils.asm file to insert a PrintTab subprogram immediatelyafter the PrintNewLine subprogram as shown below (changes are highlighted in yellow).The programmer complains that the PrintTab command cannot be called using the "jalPrintTab" instruction. What is wrong, and how can this be fixed? Explain all theproblems in the code this programmer has written.# subprogram: PrintNewLine# author: Charles Kann# purpose: to output a new line to the user console# input: None# output: None# side effects: A new line character is printed to the# user's console.textPrintNewLine: li $v0, 4 la $a0, __PNL_newline syscall jr $ra .data __PNL_newline: .asciiz "\n"PrintTab: li $v0, 4 la $a0, tab syscall jr $ra.data tab: .asciiz "\t"
Project 1-UNIX Shell Design a C program that copy the file "input.txt" to "out.txt" using Ubuntu (Linux) system calls. The program will create the directory (~/OS-Project) to store the file "out.txt" inside it. The program will skip m letters at a time. The process of reading will start from the letter of index i. The values of m and i must be provided by the user.
Through this programming assignment, the students will learn to do the following: Practice processing command line arguments. Perform basic file I/O. Use structs, pointers, and strings. Use dynamic memory. This assignment asks you to sort the letters in an input file and print the sorted letters to an output file (or standard output) which will be the solution. Your program, called codesolve, will take the following command line arguments: % codesolve [-o output_file_name] input_file_name Read the letters in from the input file and convert them to upper case if they are not already in uppercase. If the output_file_name is given with the -o option, the program will output the sorted letters to the given output file; otherwise, the output shall be to standard output. In addition to parsing and processing the command line arguments, your program needs to do the following: You need to construct a doubly linked list as you read from input. Each node in the list will link to the one in…
The ".text" section of an ELF file contains the machine code of the compiled program. Question 1 options: True False Both the ".symtab" and the ".debug" sections will be loaded into the memory when the loader loads this ELF file into the memory for execution. Question 2 options: True False For a function of "int f(){static int x = 0; return x;}", the compiler (say, gcc) will allocate space for this static variable in the ".data" section. Question 3 options: True False
Hi, in C programming , I try to implement 2 functions to check those followings instructions in a file text : The first function :Find the number of words with duplicates on a file The second function: • Find the most frequent letter (without considering duplicates) Finally write those results on another file. Thanks
Computer Science I get an error in my code: Exception thrown at 0x00000001 in Project4.exe: 0xC0000005: Access violation executing location 0x00000001. I'm confident that the Irvine32 libraries are properly implemented and I'm using MASM x86 Assembly language in C++ Please fix the code! INCLUDE Irvine32.inc .data msg_system_params db "System Parameters on Stack", 0 msg_separator db "___________________________________________", 0 msg_format db "Address: %08Xh => Content: %08Xh", 0 newline db 0Ah, 0 .code main PROC ; Set up stack frame push ebp mov ebp, esp ; Push variables onto the stack push 1 push 2 push 3 push 4 push 5 ; Call runLevelOne procedure call runLevelOne ; Clean up the stack mov esp, ebp ; Restore stack frame and return pop ebp mov eax, 0 ret main ENDP runLevelOne PROC ; Set up stack frame push ebp mov ebp, esp ; Display text "System Parameters on Stack" lea eax, msg_system_params call displayText ; Display separator line lea eax, msg_separator call displayText ;…
C Programming: Write a separate program that takes one command line argument indicating a binary stack file (e.g., stack.bin). Provide an appropriate error message in case of a missing filename or error opening it. The sample output is shown below that it must print out. Show the full code with the sample output being run in the terminal. There must be no errors at all. Sample Output: function: 0x5639db7fc2ca, caller: 0x7f8b8f372290, frame pointer: 0x7ffd23831070stack frame: 0x7ffd23831080-0x7ffd23831070, time: 0.003484 (2158-5642)address range initial final0x7ffd2383107f-0x7ffd2383107c: 00007f8b | 00007f8b0x7ffd2383107b-0x7ffd23831078: 8f372290 | 8f3722900x7ffd23831077-0x7ffd23831074: 00000000 | 000000000x7ffd23831073-0x7ffd23831070: 00000001 | 00000001 function: 0x5639db7fc1d9, caller: 0x5639db7fc2f3, frame pointer: 0x7ffd23831050stack frame: 0x7ffd23831060-0x7ffd23831030, time: 0.002587 (2173-4760)address range initial…
Computer Science Write a Python function that takes in a socket, and reads in bytes from the socket connection until a newline is encountered. All bytes read so far that are even (0, 2, 4, 6, 8) are then returned. Do not handle exceptions; assume all parameters are valid
PLEASE MODIFY THE BELOW CODE BY USING INTERRUPTS. #include <iostream>#include <cstdlib>#include <time.h>#include <chrono>#include <pthread.h> using namespace std::chrono;using namespace std;#define NUM_THREADS 40 struct AddTask{int *v1,*v2,*v3;int start;int end;}; void randomVector(int vector[], int size){for (int i = 0; i < size; i++){ vector[i] = rand() % 100;}} void *AddVector(void* arg){ AddTask *task = (struct AddTask *) arg; for(int i = task->start; i< task->end ; i++){task->v3[i] = task->v2[i] + task->v1[i];}} int main(void){ pthread_t threads[NUM_THREADS]; unsigned long size = 100000000; srand(time(0)); int *v1, *v2, *v3; auto start = high_resolution_clock::now(); v1 = (int *) malloc(size * sizeof(int *));v2 = (int *) malloc(size * sizeof(int *));v3 = (int *) malloc(size * sizeof(int *)); randomVector(v1, size); randomVector(v2, size); for (size_t i = 0; i < NUM_THREADS; i++) {struct AddTask *task = (struct…
Which of the following is not a programming convention to avoid a potential pitfall associated with the use of smart pointers? If you use a smart pointer and an exception occurs in your program, remember that you must use the delete operation to manually free the memory associated with the smart pointer. Don't use get() to initialize or reset another smart pointer. If you use a pointer returned by get(), remember that the pointer will become invalid when the last corresponding smart pointer goes away. Don't delete the pointer returned from get). If you use a smart pointer to manage a resource other than memory allocated by new, remember to associate a deleter function when declaring the smart pointer. Don't use the same built-in pointer value to initialize (or reset) more than one smart pointer. O O