hat happens during the active segmentation stage of zygote?

Q: what is the most challenging behavior to control for maintaining a healthy body composition? Why?

A: Body composition can be defined as the relative ratio of muscles, bones, fat, water and other…

Q: Which is more problematic for a cell? a. Inversion with break point between genes b. Inversion with…

A: Mutations are the random changes that alter the genetic material of an individual. This results in…

Q: A 57-year-old woman comes to the physician because of vaginal bleeding and discharge for 3 weeks.…

A: The surgical removal of the uterus is known as a hysterectomy. You lose your ability to conceive…

Q: "As development progresses, individual cells become more and more restricted in the range of cell…

A: The capacity of a cell to differentiate into one or more specific cell types is known as its…

Q: Identify the muscles and mention their functions. A B C

A: Muscular system is specialised system which help in movement of body  Muscular system involves --…

Q: In a gorilla population in Zaire we consider a single gene locus with two alleles G and g, with G…

A: The Hardy-Weinberg formula is written as follows: p2 + 2pq + q2 = 1. Here, p represents the…

Q: The correct description of altruism by kin selection is that O An individual helps because all of…

A: The coefficient of relatedness (r) is a measure of how related two individuals are. It is usually…

Q: give 5 references in APA format about parasitic crustaceans of farmed fish.

A: parasitic crustaceans of farmed fish the most harmful parasites of fishes. Certain paracitic species…

Q: Individuals undergoing anti-angiogenesis therapy with VEGF inhibitors often show initial reduction…

A: Vascular endothelial growth factor (VEGF) is a potent angiogenic factor and was first described as…

Q: Which stage of meiosis involves the separation of homologous pairs of chromosomes?     anaphase…

A: Meiosis is a cell division which reduces number of chromosomes in gametes. In humans, somatic cells…

Q: According to the film, Your Inner Monkey, grasping hands evolved: A. to allow grooming for social…

A: In relation to finger length, the human opposable thumb is longer than those of other primates.…

Q: 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop…

A: Transcription and translation are terms used to describe two distinct biological processes: the…

Q: When a hospital acquired infection occurs due to the transmission of bacteria from one person, to…

A: Disease interferes with biological processes; it is distinguished by particular symptoms and…

Q: Homologous chromosomes Meiosis Eggs Sperms Gametes Fertilization Zygote Dominant alleles Recessive…

A: Introduction A concept map is a conceptual diagram that represents the relationships between various…

Q: The students  also collect samples of topsoil from an area under some trees.describe an experiment…

A: Introduction  Soil is home to not only plants but also inhabits a wide variety of animals such as…

Q: How many chromosomes were present before mitosis?  How many chromosomes did each of the daughter…

A: 1 answer - There are 46 individual chromosomes in each cell. With 92 individual chromatic are…

Q: Transcribe the strand below: ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG

A: The initial stage of gene expression, transcription, uses information from a gene to build a…

Q: A 23-year-old male has been diagnosed with a tumor impinging upon his spinal cord. He has started to…

A: The conus medullaris is the spinal cord's terminal end, and in a typical adult, it is located at the…

Q: For any gene with a dominant allele A and recessive allele a, what proportions of the offspring form…

A: Homozygous dominant: If an  individual has two dominant alleles  is said to be homozygous…

Q: "Were the various types of cells to lose their stickiness for one another and for the supporting…

A: In the majority of tissues, transmembrane proteins that are intracellularly connected to the…

Q: have

A:

Q: What is the correct function of the lymphatic capillaries?      production of pre-B and pre-T cells…

A: Lymphatic capillaries These are very small, extracellular fluid-processing microvessels with thin…

Q: A researcher engineers a lac (lactose) operon on a plasmid but inactivates all parts of the lac…

A: Introduction Lac operon  ,this concept was proposed by Jacob and monod in 1965. Operon is a…

Q: Endocrine

A:

Q: Orrorin tugenesis may be the earliest hominin because it has a thigh bone that the discoverers say…

A: Orrorin tugenensis, who lived around 6 million years ago, is one of the oldest early humans on our…

Q: According to the findings, the challenges of preventing non-communicable diseases were classified…

A: Introduction Communicable diseases are diseases that can be spread from one person to another. They…

Q: INSTRUCTION • Answer the question properly • Do not copy here in Bartleby or Google. QUESTION 1.…

A: A trait is any characteristic that an organism may possess due to its genetic makeup. The trait is…

Q: If a scientist wanted to introduce a transgene into a plant, which of these techniques would they be…

A: D.) Infect plant cells with bacteria containing T-DNA.

Q: How is it possible for a bacterium to grow in a hypertonic environment?

A: A hypertonic environment is an environment where the external surrounding media have a higher…

Q: RNA polymerase functions during? replication translation. transcription. duplication.

A: RNA polymerase- It is the key enzyme in each living organism. It has six subunits- α(2), β, β', ω…

Q: Explain in detail the importance of experiment by Ernst Chain and Norman heatley

A: The pathogenic germs are usually stated that they are been known as they  are invading are killed or…

Q: In certain breeds of chicken, the appearance of the comb (a fleshy growth or crest on the top of the…

A: A trait is a characteristic feature that is unique to particular individual. Each trait is…

Q: make an introduction about making fermentation of fish

A: Food is a necessary component of human life. Nonetheless, some meals can harm a person's body,…

Q: Which of the following is also called a CD8 or killer T cell? Macrophage B lymphocyte Ohelper T…

A: Introduction:- A complex system consisting of different cells and organs that protects our body by…

Q: A 25-year-old soldier suffers a gunshot wound on the lower part of his back and is unable to move…

A: Almost every element of our health and wellness is influenced by the neurological system. It directs…

Q: Where were the earliest Homo erectus fossils found (not the first ones discovered)? How old are…

A: Homo erectus is also referred as the upright man. It was the first of our ancestors to have…

Q: In somatic cell nuclear transfer, the nucleus of a somatic cell is inserted into an enucleated egg.…

A: A somatic cell nucleus refers to a cell whose nucleus has a diploid set of chromosomes which means…

Q: e pathway energy would take beginning with a photon striking ere does this energy reside at the end…

A: PSI pathway: It is the pathway through which photosynthesis occurs with the transmission of light…

Q: In kangaroos, pouched kangaroos (P) are dominant over pouchless kangaroos (p) and bushy tails (B)…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: 5 Examples of adult cytogenetics test and applications

A: Cytogenetics is the branch of genetics deals with the study of chromosome abnormalities like…

Q: Why is erythropoietin a popular drug among athletes? Explain with the physiological mechanism. BIUG…

A: The primary hormone controlling red blood cell (RBC) formation is erythropoietin (EPO). Recombinant…

Q: Examine whether the statement, "Pathogens must enter host cells to cause disease", is true or false.

A: A class of bacteria is generally known to state they are like pathogens capable of causing disease.…

Q: Identify this organism by its phylum

A: Some unicellular organisms are believed to be the ancestors of animals. Protista is a group of…

Q: 34. Which of the following best describes the epithelium in the histologic section shown? A)…

A: INTRODUCTION:- A tissue is a group of one or more types of physically linked cells…

Q: dry fruits over fleshy fruits

A: Dry fruits: These are the fruits from which the majority of the original water content has been…

Q: hotosynthesis that describes the reactions of photosynthesis. Word Bank: Processes: ATP Synthase,…

A: An autotroph is an organism that synthesizes complex organic compounds such as carbohydrates,…

Q: reflective ward be green II. Extract chlorophyll from geranium leaves by boiling in ethanol until…

A: Chlorophyll The green pigment found in plants is called . It aids in the production of starch…

Q: dependent reactions of photosynthesis? O O O O A. NADPH B. 0₂ C. ATP D. H₂O

A: The light dependent reaction in photosynthesis is the process of converting the light energy coming…

Q: What is cocaine still used for medically?

A: Cocaine is a powerful addictive stimulant drug and it can be obtained from the leaves of two coca…

Q: The plant picture below, and most likely have what type of root system

A: The part of the plant axis that is descending towards downward direction is referred as the root…

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase. 

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons: