Given the mRNA sequence ,5’-AUGUACAAGGUCGGAUGA-3’ which of the following amino acid sequence would result from translation? Tyr-met-val-lys-gly Met-val-lys-tyr-gly Met-tyr-lys-val-gly Ser-arg-leu-glu-his-val Gly-met-val-lys-tyr
Q: Intro to Neuroscience Limbic System, Emotion, Reward, and Addiction List the brain regions…
A: The brain regions involved in reinforcement and reward are primarily part of the limbic system and…
Q: The function of the pampiniform plexus is to cool the arterial blood flowing to the testes. produce…
A: The correct answer is option A. Cool the arterial blood flowing to the testes.
Q: Part 1: Describe the differences in SNP diversity and LD structure observed between African and…
A: The degree of variation found in single nucleotide polymorphisms (SNPs), the most prevalent kind of…
Q: Using the base pairing rules which three complimentary dna bases pair with the following dna codon…
A: All living organisms have nucleic acid based genetic material, either DNA or RNA. The primary…
Q: Which statement about glutamate and DA in regard to symptoms associated with schizophrenia is true?…
A: A severe and long-lasting mental illness that alters thoughts, feelings, and behavior is…
Q: 4. (8 points) The graph below shows the progress of a chemical reaction inside a cell. Write the…
A: The correct answers can be identified as follows-a. The reactants are indicated by A on the…
Q: Addition of 3’-CCA to tRNA is an example of which of the following? Post -replicational modification…
A: The question is asking to identify the type of modification that is represented by the addition of…
Q: Is this circuit correct
A: Yes, the cirucuit is correct.Thе Papеz circuit, first proposеd by Jamеs Papеz, is a nеural pathway…
Q: If the other three forces that determine fluid movement were unchanged, an increase in blood…
A: The objective of the question is to understand the effect of an increase in blood hydrostatic…
Q: Pairwise genetic diversity in humans is â = 0.0005/bp and in cockroaches it is ✩ = 0.01/bp. You can…
A: The biological variety that exists within species is referred to as genetic diversity. It allows…
Q: Is it true that typically, barrier methods of birth control have lower actual use effectiveness…
A: Birth control refers to the use of procedures or equipment to prevent unintended pregnancy. It is…
Q: C I B TT -0 E Process C is called [Select] occurs in the [Select] molecules A, B and [Select]…
A: ETS or electron transport system is located in the inner mitochondrial membrane. It helps in release…
Q: what is the mode of action of abamectin in insects?
A: Abamectin is an insecticide and acaricide derived from the bacterium Streptomyces avermitilis. It…
Q: In fruit flies, the red allele is dominant to the allele for sepia eyes. In a certain population of…
A: The square expansion of the allele frequencies represents the relationship between genotype…
Q: Case #8: A 7-year old child has had a sore throat for 2 days. She now presents in the clinic with a…
A: The objective of the question is to understand why antimicrobial drug therapy is usually recommended…
Q: Which of the following relations will be found in the percentages of bases of a double-stranded DNA…
A: Understanding these relationships is fundamental to comprehending the structural principles of DNA.…
Q: Which pathways are stimulated by glucagon? Select all that apply. glycolysis glycogen metabolism…
A: The pancreatic islets of Langerhans cells release the peptide hormone known as glucagon. The most…
Q: List and describe each of the anatomic structures involved in the special senses of taste, smell,…
A: We can describe the anatomical structure involved in special senses as follows-1. TastеTastе Buds:…
Q: Based on the picture, which of the following functional groups is found in molecules #8? A. Amino B.…
A: Functional group is an atom or group of atoms present in a molecule that determines the function or…
Q: Which of the following represents bi-substrate mode of enzyme substrate binding? O Lock-and-Key…
A: Enzyme-substrate binding is an important step in enzymatic processes.The Lock-and-Key paradigm…
Q: For the following problem, indicate whether enzyme is repressed (-) or produced (+). Please show all…
A: The lac operon is a set of genes that are used in the metabolism of lactose in E. coli. The operon…
Q: name the organ on the fetal pig brain
A: Fetal pigs are the unborn piglets killed by industries for the production of meat. Generally, pigs…
Q: 2. Does inspection of the data in the table show a correlation (interconnection) between the…
A: 2) Yеs, there is a correlation between the magnitude of earth quake and loss of human life3)…
Q: n associative learning studies of monkeys, dopaminergic neural activity in the ventral tegmental…
A: Research on primates provides insights on the evolution of humans and the behavior of extinct…
Q: Which of the following is the best example of negative feedback for a steroid hormone?…
A: The endocrine system of the body releases hormones that act as chemical messengers. These chemicals…
Q: ) What does these results mean as shown in the three graphs and t-tests? 2) Can you explain why…
A: 1) In analyzing thе rеsults, it is еvidеnt from Graph 3 dеpicting lеaf counts that thе control group…
Q: Which statement correctly describes the transcription of DNA? It produces amino acids It produces…
A: The objective of the question is to identify the correct statement that describes the process of…
Q: Deforestation has contributed to erosion and dramatic flooding, particularly in parts of Asia. is…
A: Deforestation, the clearing of forests, is a significant environmental issue with far-reaching…
Q: Which of the following accurately represents the general ionic concentrations we tend to observe in…
A: Understanding different physiological forms requires an understanding of the ionic concentrations in…
Q: Since the query’s are matching does that mean the house mouse( mus musculus) is a good model to test…
A: Thе BLASTP analysis providеd here dеmonstratеs a high dеgrее of sеquеncе similarity bеtwееn thе…
Q: Gastrin, cholecystokinin, secretin, motilin, and glucose-dependent insulinotropic peptide are…
A: There are endocrine cells all across the gastrointestinal system. These cells produce a wide range…
Q: ased on the NCBI blast below Are there any pathogenic missense mutations in the human gene FGFR3?…
A: Thе providеd NCBI BLAST rеsults show a comparison bеtwееn thе fibroblast growth factor rеcеptor 3…
Q: There is an outbred population of mice living in a farmer’s field. Mutations occur at a gene called…
A: A population is a group of individuals of the same species inhabiting a specific geographical area.…
Q: Is this correct??? or is it the other way around
A: The dynamics of isolated populations on the Bahamian island of Andros present an intriguing…
Q: A certain section of the coding (sense) strand of some DNA looks like this: 5- ATGGGCCACTCATCTTAG-3'…
A: Mutations are changes in the nucleotide sequence of DNA. The mutations can therefore affect the…
Q: Select all that apply. A molecule of Vitamin B6 has the formula C8H11 NO3, from this you can…
A: The objective of the question is to understand the molecular structure of Vitamin B6 and its…
Q: Why is stimulating cells with LPS done for Splenocyte Preparation
A: Any form of white blood cell that is found in the spleen or has been isolated from splenic tissue is…
Q: At which end of the pigs body are the organs in the image below found?
A: Pigs are mammals that share common characteristics with humans, such as body hair, complex organ…
Q: The subunits of hemoglobin and myoglobin share structural similarities. Some residues are…
A: Hemoglobin and myoglobin are two types of globular proteins that bind to oxygen. Hemoglobin is found…
Q: Ecology Lab Worksheet 8: Species Diversity Habitat 1 Garage Lake N (Total number of individuals in…
A: Habitat 1: Garage Lake NTotal number of individuals in all species (N) = 325Number of species (S) =…
Q: Which functional groups are present? H N-C-C CH2 OH Copyright © 2009 Pearson Education, Inc. H H…
A: The objective of the question is to identify the functional groups present in the given molecule H…
Q: C4 plants outgrow C3 plants in hot climates because O They temporally separate the initial carbon…
A: The plant kingdom includes multicellular, photo autotrophic eukaryotes. These organisms have a cell…
Q: For this pedigree, assume all individuals are homoplasmic, but people from different families have…
A: Mitochondrial DNA (mt DNA) is a circular chromosome found inside mitochondria. Unlike nuclear DNA,…
Q: What are some of the technical challenges of cloning a mammoth? Check all that are true Ancient…
A: Cloning a mammoth involves using advanced genetic engineering techniques to recreate a living…
Q: You are studying a mouse model of gastrointestinal infections and isolate cells and proteins from a…
A: Antibodies, also known as immunoglobulins, are proteins produced by the immune system to neutralize…
Q: Please give me long detailed answer
A: Constitutive heterochromatin refers to regions of the genome that are consistently condensed and…
Q: If this was a prokaryote where in the cell would this image be from?
A: Protein synthesis is a biological process that allows individual cells to build specific proteins.…
Q: Go ahead and repeat the translation process but for Transcription translation Sequence II. Once you…
A: The process of producing proteins from an mRNA template is referred to as translation. Ribosomes…
Q: Shown below are several next-generation sequencing reads from a sample you have. Which of the…
A: Genomic research has been revolutionised by next-generation sequencing (NGS), commonly referred to…
Q: What's the tRNA strand for the following mRNA strand: AUGGCUAACCUUGUA
A: Gene expression is the procedure through which data from a gene is employed in the production of a…
Given the mRNA sequence ,5’-AUGUACAAGGUCGGAUGA-3’ which of the following amino acid sequence would result from translation?
Tyr-met-val-lys-gly
Met-val-lys-tyr-gly
Met-tyr-lys-val-gly
Ser-arg-leu-glu-his-val
Gly-met-val-lys-tyr
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu synthetase, how will the following peptide sequence change upon mRNA translation? wild-type: Met-Lys-Leu-Pro-Ala-Leu-Val-Val-Ala O Met-Lys-Leu-Pro-Ala-Leu-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Val-Val-AlaA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)What amino acid sequence does the following mRNA nucleotides sequence specify? 5'- AUGGCCAGCUGU -3' Express the sequence of amino axis's using the three-abbreviations, separate hyphens (e.g., Met-Ser-Thr-Lys-Gly).
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3 NH3+- Met-Leu-Phe-Val- COO- NH3+- Met-Thr-Val-Ser- COO- NH3+- Met-Glu-Gln-Ser- COO- NH3+- Met-Asp-Ser-Pro- COO- NH3+- Met-Lys-Phe-Leu- COO-
- Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUGiven the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.
- Which of the following polypeptides (written from their N terminal ends) is encoded by the following mRNA? (hint: there is no left or write in a cell!) 3' GG AUG AGU AUA CUU ACG GGU GAA GUA CAU UAA CCC C5' O O O Met Lys Trp Ala Phe lle Met Ser lle Leu Thr Gly Glu Val His Tyr Lys Arg Thr Phe Tyr Met none of the above His Val Glu Gly Thr Leu lle Ser MetUsing the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A GWhat is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?