Answered: For each of the following RNA…

For each of the following RNA molecules: Indicate if it is Required or Not for translation in prokaryotes and, if it is required, what does it do? mRNA tRNA rRNA snRNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Related questions

Q: I. Euchromatin is typically gene-rich and composed of loosely packed DNA. II. Heterochromatin…

A: Chromosomes are the condensed form of chromatin. Chromatin gets folded and highly packed to form…

Q: Prions (a) consist of RNA with no protein coat (b) are misfolded proteins (c) cause several…

A: A prion is described as a type of protein that has the ability to trigger the normal proteins that…

Q: The number of high energy molecules. / [ Choose ] arrangements (do not count ADP). The number of…

A: Metabolic cycle- are reactions that occurs in body to make products in smallest forms.

Q: How might one test whether the differences in moth density in the two types of plants are due to…

A: Answer :- When sent consistently in the field, hereditarily controlled plant obstruction is…

Q: Please answer asap and in short and content should not be palgarised please This field is a…

A: ANSWER;- D) biotechnology Explain;- Biotechnology is the utilization of science to take care of…

Q: The science of producing and transmitting sound waves in materials has become widespread with many…

A: The ultrasonic waves have good propagation in the human body. Thus, it have been widely applied in…

Q: Once in human cells, which of the following statements might best describe how COVID19 replicates?…

A: Coronaviruses make full-length copies of their genomic RNA, which are integrated into freshly formed…

Q: Fill in the blanks. In the Nitrogen cycle, into are responsible for converting denitrifying…

A: Nitrogen cycle is a biogeochemical process which transform the inert nitrogen present in the…

Q: The embryo of monocotyledonous seed consists of one large, shield shaped cotyledon. What is it known…

A: Seed: A seed is an embryonic plant with a protective coating around it. Seed development is a phase…

Q: The histone protein H4 from cows and the H4 from peas, representing groups that diverged from one…

A: The high levels of core histone sequence conservation are thought to be due to severe structural…

Q: In fruit flies, the allele for long wings (L) is dominant to the allele for short wings (l). If a…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: _______function(s) in the movement of cnidarians. a. A hydrostatic skeleton c. Cnidocytes b. Tube…

A: Phylum cnidarian is coelenterates that lack the body coelom (acoelomate). They are marine animals…

Q: How do prokaryotes reproduce? What mechanisms result in gene transfer?

A: Introduction:- Prokaryotes are creatures without a nucleus or other organelles in their cells.…

Q: compare and contrast different approaches for assessing genome assemblies using assembly…

A: Genes are hereditary functional units that are made up of DNA (deoxyribonucleic acid). The genome is…

Q: functional insulin requires the association of two polypeptides known as the A and B chains…

A: The processes through which polypeptide can be changed after translation are known as…

Q: Transcribe and translate the RNA. AUG GAG CAU CCU UGG GCA GCC UUA

A: Transcription and translation Transcription is the process when the DNA is converted into RNA. and…

Q: Which of the following describes a strategy that can reduce land, water, and energy use in meat and…

A: Farming is the act of working the ground, planting seeds, and growing the edible plants. It can also…

Q: Direction: Explain the following in paragraph form consists of at least five sentences for each…

A: Introduction Sex determination is the process, by which the sex of the organism is initially…

Q: Mention the name of the hormone which inhibits the release of growth hormone from the Pituitary…

A: The term "growth hormone" is generally been stated to describe and defined as follows:1. The growth…

Q: Understand how a cancer cell from a primary benign tumor is able to leave the primary benign tumor…

A: Cancer metastasis is the spread of cancer cells to tissues and organs beyond where the tumor…

Q: Which of the following replication enzymes will most likely be involved in COVID19 RNA replication?…

A: Coronaviruses (CoVs) are the most common type of virus in the Nidovirales order, which comprises the…

Q: differential gene action or selective expression of genes confers to the phenotype of the cell true…

A: ANSWER;- false

Q: discuss the compositions of esophagus and lung tissue by comparing their density when placed in…

A: FEATURES OF THE STRUCTURE: The oesophagus is a muscular tube that connects the throat to the…

Q: A patient has reduced FEV1, and lower lung volumes overall. What is your diagnosis? the patient…

A: The quantity of air one can drive out of the lungs in one second is known as FEV1. Spirometry,…

Q: e the types of gametes the F1’s may be expected to form and the proportion of each. c. What are the…

A: Autotetraploidy is a genetic abnormality defined by the presence of four times the haploid number of…

Q: Which of the following can reduce your "foodprint" on the environment? 1. Decrease plant-based…

A: 2&3

Q: Biotechnologies used in crop production have increased our food supplies, but this food abundance…

A: A food store chain or food system refers to the cycles that depict food from a farm winds up on our…

Q: Most enzymes are: O Nucleotides Proteins O O O O Lipids O Carbohydrates

A: As we know that an enzyme is a biocatalyst that increases the rate of chemical reaction .All the…

Q: You are a legislator in a nation with no endangered species act. You want to introduce a law to…

A: Extinction is the extinction of a species or group of taxa. The death of the last member of a…

Q: Do the calibration factor computed varies according to different magnification (objective lenses…

A: By simply accounting for the inaccuracy, the Correction Factor allows us to attain more accurate…

Q: How is it that protein–protein interactions thatare too weak to cause proteins to assemble in…

A: Protein is usually defined that they are about to define as a highly complex substance found in all…

Q: When one cell sends a signal and nearby cells receive it, their signaling types is: O Direct O…

A: Introduction The ability of a cell to receive, process, and transmit signals with its environment…

Q: For eukaryote cells to evolve into new types of eukaryotic organism, which of the following would…

A: a) All the cells in eukaryotes are not identical. Different eukaryotic cells vary in shape, size,…

Q: 13. A silent mutation A) does not change the protein that is produced. B) has a very minor change on…

A: In our existing nature, the mutation is very dynamic and it subjects to various types of heritable…

Q: eukaryote cell typically has enough available ATP to meet its needs for about 90 seconds. What would…

A: Eukaryotes are life forms whose cells contain a nucleus and other membrane bound organelles. There…

Q: Immunohistochemistry is routinely used to determine specificity and identification of disease.…

A: Immunohistochemistry is a immunostaining process in which antigens in the cells are identified by…

Q: IP3 binds to---- and DAG binds to O Calcium channel of SER/Protein Kinase C O Nucleus/Plasma…

A: IP3 stands for Inositol Triphosphate. DAG stands for Diacylglycerol.

Q: In guinea pigs, the trait for ruffled fur is dominant over the trait for smooth fur. If a…

A: As ruffled fur (R) is dominant over smooth fur (r). Heterozygous male × homozygous recessive female…

Q: The TATA-binding protein (TBP) is thought to be necessary for transcription in all eukaryotic cell…

A: The TATA-binding protein is a generic transcription factor that binds specifically to the TATA box…

Q: O Isotonic solutions. Pepsin enzyme becomes denatura Owhen pH is acidic O Temperature is very high O…

A: Temperature is very High.

Q: Biological membranes are: O Fluid Selective permeable Mosaic All of the above

A: Biological membrane aur also known as cell membrane or plasma membrane is the outermost membrane…

Q: Question 12 A student performing a biological specimen studies using cancer cells, wants to check…

A: methyl orange is used as indicator, this value is also known as the m-value. The method is suitable…

Q: 9. Some biologists contend that the term double fertilization is a misnomer and that the process…

A: Fertlizatiion is the process of the male gamete, sperm, fusing with the female gamete, the ovum,…

Q: 1) Determine the MICS on the simulated microbroth-dilution results from an MIC Assay on…

A: As we know that MIC assay is used to determine the minimum inhibitory concentration of any chemical…

Q: 1. Identical twins may show dissimilar phenotypes due to changed methylation patterns of the…

A: * monozygotic twins even they are genetically identical there will be some variation in them the…

Q: Give a brief description of a typical eukaryotic cell cycle, indicate during which phase DNA…

A: * cell cycle consists of four phases . They are G1 phase S phase G2 phase M phase * During G1…

Q: Practice TEXT ANSWER The inheritance patterns for some traits in guinea pigs are listed in the table…

A: 1. The phenotype of a guinea pig with the genotype HhBBrr is: short, black hair with smooth texture.…

Q: What advantage does the retrovirus that causes AIDS have comparedto an RNA virus?

A: HIV is a retrovirus categorized as enveloped virus containing a single-stranded, positive-sense RNA…

Q: Which tissue type or organ is correctly matched with its germ layer tissue? A) nervous–mesoderm B)…

A: Introduction :- The mesoderm is a germ layer that develops between the ectoderm, which produces skin…

Q: 18. Which of the following entities has the largest interaction cross-section (most likely to…

A: Tissues are group of cells having similar function and structure.

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

Please answer asap and in short and content should not be palgarised please For each of the following RNA molecules: Indicate if it is Required or Not for translation in prokaryotes and, if it is required, what does it do? mRNA tRNA rRNA snRNA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step 5

Trending now

This is a popular solution!

Step by step

Solved in 5 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

All of the following are needed for capping of eukaryotic mRNA, EXCEPT Question 27 options: Guanylytransferase S-AdoMet RNA 5'-triphosphatase Adenosyl-transferase Methyl-transferase
The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference between these two types of cell and suggest two reasons why eukaryotic mRNA needs to be modified before translation.
Match the regulatory RNA to each of the following descriptions. Regulatory RNA that prevents transcription by recruiting DNMT enzymes Regulatory RNA that prevents translation by acting either in cis- or trans- but not by binding RISC Regulatory RNA found only in eukaryotes that is not perfectly complementary to the target RNA [Choose ] [Choose ] [Choose ] antisense RNA siRNA IncRNA miRNA riboswitch <
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
Which of the following RNAs are required for translation? (Choose all that apply) tRNA rRNA mRNA snRNAs miRNAs
Indicate whether each of the following events occurs when tryptophan is high or when tryptophan is low by placing a check in each of the appropriate blanks. Share your reasoning. Event Tryptophan high Tryptophan low Ribosome does not stall at Trp codons ____________ ____________ Region 2 of the leader pairs with region 3 ____________ ____________ Ribosome covers part of region 2 of leader ____________ ____________ Transcription is terminated before structural genes are transcribed ____________ ____________
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing steps is splicing, where portions of the RNA are removed and the remaining RNA are joined together. Classify the statements regarding mRNA splicing as true or false. True statements False statements In splicing, intron sequences are removed from the mRNA in the form of lariats (loops) and are degraded. Splicing occurs while the mRNA is still in the nucleus. Splicing of mRNA does not involve any proteins. One MRNA can sometimes code for more than one protein by splicing at alternative sites. Splicing occurs while the mRNA is attached to the nucleosome.
The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)
Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing steps is splicing, where portions of the RNA are removed and the remaining RNA are joined together. Classify the statements regarding mRNA splicing as true or false. True statements Splicing of mRNA does not involve any proteins. Answer Bank Splicing occurs while the mRNA is attached to the spliceosome. In splicing, intron sequences are removed from the mRNA in the form of lariats (loops) and are degraded. One mRNA can sometimes code for more than one protein by splicing at alternative sites. False statements Splicing occurs after the mRNA enters the cytoplasm but before it binds to the ribosome.
Which of the following processing events occur during or after the synthesls of MRNA molecules in eukaryotes? Intron splicing Addition of a 5'cap O Cleavage of multiple functional molecules from a larger precursor O Polyadenylation of the 3' end