20 ProteinsProteins are determined by the structure of DNA and RNA. DNA consists of two chains of nucleotides held together bychemical bonds. Base pairing rules determine how the bases of each chain will bond to one another. RNA also hasrepeating nucleotides, bases that are held together by chemical bonds, and specific base pairing rules, but it is a singlestrand and has different bases than DNA. The sequence of DNA is rewritten into an RNA copy which then determines thesequence of amino acids of a polypeptide chain, the primary structure of a protein. A single amino acid is added to theprotein strand for every 3 bases, or codons, in the RNA. The sequence of amino acids determines the way the protein willfold. The folding of the protein determines its function. The structure of DNA, RNA, and a protein are shown.XOXODNARNAProteinFoldedproteinThe triplet codon used to decipher the amino acids is mostly universal. Each amino acid has more than one codon.Methionine (AUG) is the initiation codon that starts the translation process. There are 3 codons that stop the translationprocess.Which statement correctly describes proteins?COOABC.ODPolypeptide chains are formed in the nucleus.DNA is the original source of protein structure.The function of a protein is determined by the RNA.Each nucleotide base is encoded into a single amino acid. The triplet codon used to decipher the amino acids is mostly universal. Each amino acid has more than one codon.Methionine (AUG) is the initiation codon that starts the translation process. There are 3 codons that stop the transprocess.First nucleotideUAGUUUUUCUUAUUGCUUCUCCUACUGAUUAUCAUAAUGGUUGUCGUAGUGU(Phe(LeuLeulle(Met)ValSecond nucleotideсUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGSerProThr)AlaUAU(Tyr)UACUAA STOPUAG STOPCAUCACCAACAGAAUAACAAAAAGAGAUGACGAAGAGHisGin(Asn)(LysAspGluUGUUGCUGAUGGCGUCGCCGACGGAGUAGCAGAAGGGGUGGCGGAGGGGCysSTOPTrp(Arg)SerArgGlyUсAGсA943GUсGThird nucleotide

Protein is made up of amino acids, which experts call them as the building blocks. Our body needs…

er by ingle es the the ein will slation Which statement correctly describes proteins? O A Polypeptide chains are formed in the nucleus. OB DNA is the original source of protein structure. O The function of a protein is determined by the RNA. O D. Each nucleotide base is encoded into a single amino acid.

er by ingle es the the ein will slation Which statement correctly describes proteins? O A Polypeptide chains are formed in the nucleus. OB DNA is the original source of protein structure. O The function of a protein is determined by the RNA. O D. Each nucleotide base is encoded into a single amino acid.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 5TYU: RNA differs from DNA in that the base _______________ is substituted for _______________. (a)...

See similar textbooks

Similar questions

RNA differs from DNA in that the base _______________ is substituted for _______________. (a) adenine; uracil (b) uracil; thymine (c) guanine; uracil (d) cytosine; guanine (e) guanine; adenine
Which of the following linkages/bonds is NOT found in the primary structure of DNA and RNA molecules? A phospho anhydride bond B phosphoester bond (c) N-C glycosidic bond phosphodiester bond
Which of the following are important chemical considerations defining the structure and function of polynucleotides? Conformation of the hexose sugar Conformation of the glyostatic bond Tautomeric conformation of the base b and c a, b, and c
In a DNA oligonucleotide, two nucleosides are linked together with a: Phosphodiester bond Phosphatic bond Phosphoester bond Glycosidic bond
The sugar of one nucleotide is attached to the phosphate of another nucleotide through a bond. ester glycosidic peptide O phosphodiester
Which of the following is true of the molecule below? nucleotide 5' 3′ H₂C H₂C TNHNA O. HN CNH…NG NH O NH O HNU NH O CNHNG OHN nucleoside CH₂ CH₂ a purine pairs with a pyrimidine base the bases are held together by covalent bonds a nucleoside is made of the same components as a nucleotide The bases make up the backbone on the sides of the molecule
Which category of RNA carries amino acids for the process of translation? rRNA snRNA mRNA tRNA
Fill in the following with the specific bond(s): Maintain(s)the helical structure of many proteins____________: ;link(s) polypeptide chains and can cause proteins tobend:_______ and________ ; join(s) the twostrands of the double helix of DNA:_________ ; link(s) amino acids to form the primary structure of proteins:_______.
01 O-P-OCH2 5 HN 6 OH CH₂
Which of the following use hydrogen bonds in the body: 1. Water (high specific heat, resist changes in body temperature) 2. secondary structure of proteins 3. complex carbohydrate structure 4. breakdown of ATP into ADP 5. Base pairing in DNA double helix 1, 2, 4 O 1, 2, 5 1, 2, 3, 5 2, 3, 4, 5 1
Select the statement that correctly describes the connection between two nucleotides: A phosphodiester bond would form between the phosphate groups of each of the nucleotides. A phosphodiester bond would form between the base of one nucleotide and the phosphate of the second nucleotide. A phosphodiester bond would form between a purine base of one nucleotide and a hydroxyl group of the second nucleotide. A phosphodiester bond would form between the phosphate group of one nucleotide and a hydroxyl group of the second nucleotide.
What are building blocks of a nucleic acid? Describe the difference of deoxyribose in the ribose structure. Describe nucleotide. Describe nucleoside. Describe ATP, ADP and AMP. Describe the directionality of DNA and RNA. Describe three components of a nucleotide. Explain characteristics (and differences) of DNA and RNA. List all DNA bases. List all RNA bases. Explain anti-parallel