Q: We have the following DNA sequence that codes for 7 amino acids of exon 1 of the dopamine receptor…
A: Here the DNA sequence is - 5' GTG CAC CTG ACT CCT GAG AAG 3' It codes 7 aminoacids. The…
Q: What information can be obtained from DIS80 primer Blast ? A Respect length and number in alleles…
A: Primer-BLAST used for design a new target-specific primers in one step . Primer BLAST check the…
Q: which of these is characteristic of gram positive, gram negative bacteria or mycobacteria have a…
A: Bacteria are microscopic prokaryotic ubiquitous organism which do not have nucleus nor membrane…
Q: Bioassay with Spirogyra and bacteria, pigments, photosynthetics T. W. Engelmann (1882) filament of…
A: Photosynthesis is the process that occurs in the presence of sunlight.
Q: does chain abberation due to translocation mutation result to fertile gametes
A: Translocation is a structural change in the chromosome and includes the exchange of chromatin…
Q: 9. Explain how a small amount of growth factor can mediate an amplified signal inside the cytoplasm…
A: Signal transduction pathways translate signals received at the cell's surface into cellular…
Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…
A: Synapse, also known as neuronal junction is the site of transmission of electric nerve impulses…
Q: give examples of 4 different values of hematocrit and explain their meaning
A: Hematocrit is a measure of the percentage of red blood cells in the body. if a person has 50…
Q: What is diabetes mellitus? Differentiate between Type I and type II diabetes
A: Introduction :- A condition in which the body's glucose (a type of sugar) levels are out of control…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: CGA codes for Arginine. GGA codes for Glycine. Since the protein being coded for is completely…
Q: Describe the properties of the genetic code - how many codins code for amino acids, stop colons,…
A: The genetic code can be defined as a set of specific rules for a living cell to translate…
Q: Distinguish between positive and negative control. Give examples of each from the lac operon
A: Operator is a unit consisting of one or more cistrons that function coordinately under the control…
Q: Discuss the types of meristems based on their position in the plant body
A: Introduction Meristem is a type of plant tissue that contains undifferentiated cells responsible for…
Q: Draw the keto or enol tautomer for each of the following compounds when they were treated with…
A: 1. Propanol on being treated with traces of acids or bases, its structure is converted to Propanone.…
Q: A classical experiment studying the fate determination of stem cells in the developing embryo uses…
A: Neural crest cells give rise to melanocytes, smooth muscles cranial cartilage, facial cartilage and…
Q: 1. Lac and Trp Operon are two different processes of sugar and amino acid. Describe the differences…
A: Lac and Trp operon are found in E. coli and other bacteria.
Q: Generally, one single mutation is enough to cause cancer. [Select] Cancer-causing mutations cause…
A: When the genes that control cell division are disrupted, cancer cells are produced. Carcinogenesis…
Q: If a small part of the cell membrane surrounds a molecule so that it can enter a cell, then the…
A: Cell membrane, also called plasma membrane is the thin membrane that surrounds every living cell,…
Q: Describe all of the ways in which RNA is modified after transcription in eukaryotic cells
A: Transcription of creating RNA from a template of DNA. It can be found in the nucleus of eukaryotes.…
Q: In most populations, population size remain near the carrying capacity as long as limiting factors…
A: Limiting resources are considered as the carrying capacity for any population.
Q: Enumerate primary organ rudiments that have started to take form in the 24 – hour chick embryo…
A: Introduction A multicellular organism's embryo is the first stage of development. Embryonic…
Q: Ant species work together to collect food and build the mounds they live within. This behavior…
A: Ants are distributed in all different habitats and everywhere on the planet but less in Antarctica,…
Q: Choose 1 biotechnology product in the field of medicine. Provide a 1-2 minute monologue about this…
A: The relationship between science and health services is that science creates medicine and methods of…
Q: a gene insert itself into a bacterium’s Genome often distracting part of the genome. This is an…
A: Several types of techniques are incorporated in the molecular biology to get more desirable results…
Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…
A: Cellular respiration, like burning, results in the complete oxidation of glucose into CO2 and water.…
Q: Which is most important in catalysis of peptidyl transfer? A Massively parallel sequencing data…
A: Peptidyl transferase is used in the process of translation where protein is synthesized. Proteins…
Q: Aa al 1 No Spac. Heading 1 Неа Lu Am Ma pod mbs Amnion Liz and Cra Ost Feathers Haw othe
A: Phylogenetic tree represents the evolutionary relationship between different organisms. The node…
Q: Which nitrogen base is found in RNA but not in DNA? Multiple Choice adenine thymine cytosine uracil…
A: ANSWER) (d) Uracil In RNA instead of Thymine there is Uracil which bind with the Adenine with the…
Q: Marie diluted her phage lysate from 10° to 109. She completed the titer assay protocol using these…
A: This question is about dilution.
Q: A carton of milk, under the right conditions, will undergo ___ type of succession.
A: Introduction Succession:- It is the change in either species composition, structure, or architecture…
Q: Pick the best answer choice from below:
A: During oxidative phosphorylation a total 2.5+1.5=4 molecules of ATP produced in one round. The NADH…
Q: Periodic and systematic assessment of health risk status classifies patients into specific…
A: To speak out for potential clients when choices concerning healthcare resource allocation are being…
Q: Which one of these molecules is part of the make-up of both DNA and RNA? Multiple Choice thymine…
A:
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: Explain why this statement is true, using phylogenetic and morphological evidence. Tunicates…
A: Explain why this statement is true, using phylogenetic and morphological evidence. Tunicates (…
Q: BLASTP helps to predict the function of phage proteins by finding the e-value of phage proteins O…
A: ANSWER) (a) finding the e-value of phage proteins The BLASTp helps to predict the function of phage…
Q: Why do scientists isolate DNA?…
A: There are different techniques to study DNA and gene present in it.
Q: Cite 3 scientists who made great contributions in the discovery/study of photosynthesis. Explain…
A: Introduction Photosynthesis:- It is a process by which plants use sunlight, water, and carbon…
Q: Primaquine is a drug used in the antimicrobial prophylaxis of: O Meningitis O Tuberculosis Malaria O…
A: Answer :- Option (C) is correct. - Malaria.
Q: Continuing from the question above. You are able to correctly modify the blood stem cells and return…
A: Sickle cell anemia is majorly due to missense mutation which results in valine substitution in place…
Q: What causes allele frequencies to differ between biological populations?
A: Allele frequency Allelic frequency can be defined as relative frequency of an allele at a…
Q: Characterize the scope of indoor air pollution and assesssolutions
A: Air pollution is the addition of substances to the air that lowers its quality.
Q: what are evidences that indivate plants are measuring the length of the night?
A: Introduction The physiological response of organisms to the length of night or a dark period is…
Q: Urinary system lab assignment and related case study Leo, 37-years old was absolutely shocked when…
A: Introduction The kidneys, ureters, bladder, and urethra make up the urinary system, often known as…
Q: Did you have an experience when a stranger acted caring and was helping you? What impact did that…
A: Empathy creates a connection that enables us to feel compassion. We can sense the suffering of…
Q: Match the following hormones with their actions: ACTH epinephrine testosterone ADH estradiol…
A: INTRODUCTION Answers to question 1-10 is given below.
Q: You are supplied with the following information about a DNA molecule: The molecular weight of a…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: The immediate product of this process is 3-phosphoglycerate. Light Reaction Calvin Cycle Both Light…
A: In case of light reaction ATP , NADPH and oxygen are the end products. The ATP acts as an energy…
Q: 2-Deoxyglucose or 2-DG is a glucose analog that binds to hexokinase (the first rate- limiting enzyme…
A: ATP is the currency of the cell and it starts with glycolysis. Glycolysis is the breakdown of…
Q: The Bax gene, codes for a cytosolic protein that plays an important role in apoptosis. Growth factor…
A: Bax gene Bcl-2-associated X protein which is pro-apoptotic member of the Bcl-2 gene family.
Equipment or materials used in immobilizing and separating cells of streak, pour and spread method.
Step by step
Solved in 2 steps
- A patient has subcutaneous nfection and the specimen is submitted on a swab . Explain why this is an unacceptable collection method . How shoul he sample be collected ?The outer surface of the product container was not disinfected. effect: rationale:Evalutation of Antiseptics/Disinfectants - Filter Paper Disk Method
- True / False Adding a UV disinfector to a pass-through window is NOT offer a higher level a safety for sterile processing personnel.Area of no growth around an antibiotic disk indicates_________________.Without water for decontamination, you are forced to improvise. What supplies would you grab? Large trash bags, plastic shower caps, scrubs, permanent markers, foley cath, aspirin, ace bandages? Select all that apply. Explain all point deeply and type the answer.
- L. MONOCYTOGENES (LISTERIOSIS) Microscopy -If gram positive or gram negative - Morphology IDENTIFICATION TEST (at least 1) -Principle -Reagents used -Procedure -Describe ResultWhich of these microbial structures is the most difficult to kill when attempting to sterilize instruments? bacterial spores Mycobacterium pneumoniae protozoal cysts fungal sporesWhy are thick or dense smears less likely to provide a good smear preparation for microscopic evaluation?