e a function called print_hangman() that takes no arguments and prints a hangman corresponding to the number of incorrect guesses (use the global variable) . Example: x = 4 # number of incorrect guesses print_hangman() O \ | /
Q: Create a python program called code.py. Write a function named divisible() that takes two integer…
A: Python program for above : import random def divisible(num1, num2): # make num1 as min and…
Q: Write a program whose input is two integers and whose output is the two integers swapped. Ex: If the…
A: def swap_values(user_val1, user_val2): temp = user_val1 user_val1 = user_val2 user_val2…
Q: Write a python program that takes in name and pay rate and the number of hours worked in a week by…
A: Algorithm : main function() Step 1 : setting number of persons(3) to a variable. Step 2 : declaring…
Q: Write a python program that uses a user-defined function that accepts name and gender (as M for…
A: Given: Write a python program that uses a user-defined function that accepts name and gender (as M…
Q: In python Write a function areaOfCircle(r) which returns the area of a circle of radius r. Test…
A: The following steps need to be taken for the given program: Create function areaOfCircle(r) with…
Q: Write a Python program that can convert a Fahrenheit temperature to Celsius, or vice versa. The…
A: Start Enter temperature by user prompt the user to enter a temperature. indicate the temperature…
Q: Write a Python function that will perform unit conversions. Your function should take two arguments.…
A: Python used to answer this question
Q: Write a python program that creates two global variables, one to store the number of incorrect…
A: here we write simple sudo code for this : if loop till 5 .
Q: Write a Python program that inputs five positive integer numbers, finds their maximum and sort them…
A: Required:
Q: Implement a function priceTShirt in Python that computes and returns the price of a T-shirt. The…
A: Python code for the given question :- def priceTshirt(size, slogan): price = 0 # add base…
Q: Create a program which the final grade is calculated from an input like the image. So with use of…
A: According to the information given:- We have to calculate the average grade from where the final…
Q: Create a python program that would perform the given description below A. The original Caesar cypher…
A: Program def encrypt(text,s): result = "" # transverse the plain text for i in range(len(text)):…
Q: python Write a function shampoo_instructions() with parameter num_cycles. If num_cycles is less…
A: Corrected program code: def shampoo_instructions(user_cycles): if user_cycles<1: print('Too…
Q: write a python program to Create a variable containing the DNA sequence: ACGCAGAATGCTTAGGACTAGTTAC…
A: Start Declare a variable dna and initialize value Replace T with U and store it as rna Print middle…
Q: Write a Python function greeting that, given a string and a name, returns a friendly greeting…
A: Please check step 2 for the code. Please see that I have used the index function to find the index…
Q: Write program in python with a function occupy(n), which shows how birds are going to occupy n…
A: Given that, Writing a program in python with a function occupy(n), which shows how birds are going…
Q: Write a Python program that converts miles to kilometers and kilometers to miles. The user will…
A: logic:- take choice input from user. pass it to function, and do conversion as per the above…
Q: Write a Python function that reads on the keyboard as input an integer (int) n greater than or equal…
A: Python program to solve the given problem is below.
Q: ython function that takes a positive integer n and returns the sum of the squares of all the…
A: Code: def sum_of_sqs(n): sum = 0 while n > 0: n -= 1 sum += n**2 return…
Q: Write a short Python function, is_multiple(n, m), that takes two integer values and returns True if…
A: here in this question we have asked to write a program which take two integer input from user. and…
Q: Write a Python function calculateDistances (v) that calculates the distance (horizontal, in meters)…
A: We will use newtons formula to find the total distance and take g as 9.8 We break the interval into…
Q: Write a Python program that will input three integers numbers, computes their average and sort them…
A: #getValue function def getValue(msg): return map(int,input(msg+": ").split()) #ascsortNavg…
Q: Write a Python program that asks the user for a quantity then takes that many numbers and prints the…
A: Here I have taken input from the user and then stored it into variables. Next, I have used a for…
Q: Write a python function called substrand() that takes two DNA strands (strings) as parameters and…
A: The find() method finds the first occurrence of the specified value. The find() method returns -1 if…
Q: Write a python function matching the docstring below. You do not have to include the docstring in…
A: According to the provided information, The python function should convert a time (string) in Eastern…
Q: Write a computer program using C++ to compute the expression (n*(2^m!)), Where n, m are positive…
A: #include<iostream> #include<math.h> using namespace std; int fact(int num)…
Q: Implement a fahrenheit function that returns theFahrenheit equivalent of a Celsius temperature. Use…
A: def celciusToFahrenheit(cel): #function that takes in one numeric argument representing a…
Q: Define a function main that will draw a circle with the following parameters when the program is…
A: Python code is as follows:-
Q: Using Python, use import sys to create a program Create a program change.py, that has a function…
A: def value_of_change(l): quarters = .25 dimes = .10 nickels = .05 pennies = .01 total…
Q: Write a Python function called which reads as input an integer (int) n greater than or equal to 10…
A: Given: There is a equation given: r2 – n + 10 = 0. Goal: reads as input an integer (int) n greater…
Q: Write a Python programs to do frequency counting of the sum of two dice. Your function should…
A: CODE:- from random import randrange def sim_dice(n):# The sum of two dice range from minimum of 2 to…
Q: Encapsulate the following Python code from Section 7.5 in a function named my_sqrt that takes a as a…
A: I'm providing the python code, SS of code for reference, and then the output. I hope this will help.
Q: Write a Python program which will calculate and display on the screen the number of possible…
A: Required:
Q: Write a program whose input is two integers and whose output is the two integers swapped.
A: The header stdio.h represents Standard Input Output. The data identified with input/yield…
Q: ng until the value of the equations is less than 10-6 The code will print to the screen the…
A: Create an array of structures. Open the file. Store the file data into an array of structures. Close…
Q: Write a Python program that asks the user for a quantity then takes that many numbers and prints the…
A: #function find minimumdef mi(list): c = list[0] #first number is smallest for n in list:…
Q: We are going to write a program to create a word puzzle. For now, what we need is a function…
A: clear;clc[l, n] = promptletnum;fprintf('We will find words that contain the \n')fprintf('letter'' %c…
Q: In python, create a program, "change.py", that has a function that takes 4 arguments that correspond…
A: We assume A penny is worth 1 cent A nickel is worth 5 cent A dime is worth 10 cent A…
Q: Write a function to find the best exchange rate from one currency to another currency: Given list…
A: Python Code: from collections import defaultdictfrom collections import deque # convert functiondef…
Q: Write a Python program (L Fahrenheit. The user will indicate both a temperature value and a choice…
A: the question asks that we have to create a menu based temperature conversion system. here, at first,…
Q: Write a Python program that will convert temperature Fahrenheit to Celsius and Celsius to…
A: - We need to convert the temperature from celcius to farenheit or farenheit to celcius in python…
Q: Write a python program. Write a function called guess() that does the following 1. takes a character…
A: Algorithm : Step 1 : declare global variable word. guess function definition : Parameters :…
Q: python Write a function absolute(x) that prints the absolute value of x
A: Task :- Write a function absolute(x) that prints the absolute value of x . Python Program :-…
Q: Write a Python program that inputs five positive integer numbers, sorts them in descending order and…
A: Code: #Function to enter positive and distinct integers.def getValue():#Variable that runs loopflag…
Q: Write a python function called findTriangleArea (a, b, c) that can use Heron's formula to find the…
A: Code: def findAreaTriangle(a,b,c): s = (a + b + c) / 2 area = (s*(s-a)*(s-b)*(s-c)) ** 0.5…
Q: In this project you are asked to write the Python program to compute the solutionstroots or zeros)…
A: python program 1) define function quadsol() 2) take input as value a, b ,c 3) Function call
Q: Write a Python program that can convert a Fahrenheit temperature to Celsius, or vice versa. The…
A: Solution: Note : Complete python is attached at step -3. 1. Implementation of def c_to_f(C):…
Q: Python Write a function called count_dashes that takes a line of text as input and outputs the…
A: The problem is based on the basics of functions in python programming language.
Q: Write a Python program using functions that WIll ask the user for a humber, then based on tne…
A: program code: '''def main(): #toread input a=input("input number:")…
Q: Write a Python program that inputs five positive integer numbers, finds their maximum and sort them…
A: Program code: import sys#define a function getValue()def getValue(): #array of values numList = []…
Step by step
Solved in 4 steps with 4 images
- In Python: Write a function called is_prime that receives a single integer value between 1 and 50 determines whether or not the integer is a prime. To determine if a number less than 50 is prime, you only need to divide it by all prime numbers less than or equal to the square root of 50 (i.e., 2, 3, 5, and 7). If any of them are smaller than the number and evenly divide the number, then it is not prime. By definition, 1 is not prime. Your solution should use the guess-and-check pattern. Write a main() function in your file to exercise your function to show that it works correctly. Your test implementation should not rely on visual inspection to determine if the tests pass.Write a python function named pi_multiples() that takes an integer parameter num. This function repeatedly asks the user to enter an integer between 2 and 50. Assume the user will always enter an integer, but if the number is outside this range, the loop must end. So, for any integer x entered within the range, your function must do the following; if x is divisible by num (the parameter), it must multiply x by the value of pi (call it result) and maintain a sum of these results. In every iteration of the loop your function must print x and the result. And when the loop terminates your function should return the sum. To test your function, call pi_multiples() function using any integer number of your choice (for num) and print the returned value. Hint: to use the pi value do the following import math and use math.pi for the value of pi.Write a python program that creates two global variables, one to store the number of incorrect guesses and a second to store a word (example: koala). Write a function called print_hangman() that takes no arguments and prints a hangman corresponding to the number of incorrect guesses (use the global variable).
- Write a Python function that will perform unit conversions. Your function should take two arguments. The first argument is a float that is the temperature in Celsius and the second argument is a string that take on one of four values; "Fahrenheit", "Celsius", "Rankine", "Kelvin". Your function should be named temp_convert and return a float of the converted temperature. An example of using the function is shown below: new_temp temp_convert(e,"Fahrenheit") This will result in a value of 32.0 being assigned to the variable new_temp. Save your file as a pdf titled [Last Name)_[First Name) [Section]_Hmk4-5.pdf. An example file uploaded to eCampus would be Doe John_501 Hmk4-5.pdf.IN JAVA SCRIPT Create a function that returns the thickness (in meters) of a piece of paper after folding it n number of times. The paper starts off with a thickness of 0.5mm. Examples numLayers (1) "0.001m" // Paper folded once is 1mm (equal to 0.001m) numLayers (4) "0.008m" // Paper folded 4 times is 8mm (equal to 0.008m) numLayers (21) "1048.576m" // Paper folded 21 times is 1048576mm (equal to 1048.576m) (Ctrl)Write a program that generates random numbers between -25 and 25 by using the randint function. The program will add up the numbers and terminate when the sum of the values becomes zero. The program should contain the following functions: add() : add up the values main(): the function where the program execution should begin and end. randomgen(): a function that returns a number between -25 and 25 A global variable subsetsum that keeps track of the sum The program should output the count of the number of values generated before exiting saying that the subset sum was zero.
- Create a python program called code.py. Write a function named pi_multiples() that takes an integer parameter num. This function repeatedly asks the user to enter an integer between 2 and 50. Assume the user will always enter an integer, but if the number is outside this range, the loop must end. So, for any integer x entered within the range, your function must do the following; if x is divisible by num (the parameter), it must multiply x by the value of pi (call it result) and maintain a sum of these results. In every iteration of the loop your function must print x and the result. And when the loop terminates your function should return the sum. To test your function, call pi_multiples() function using any integer number of your choice (for num) and print the returned value. Hint: to use the pi value do the following import math and use math.pi for the value of pi.The following functions are all supposed to count how many times a certain base (represented as a character variable in Python) appears in a dna sequence (represented as a string variable in Python): def count1(dna, base): i = 0 for c in dna: if c == base: i += 1 return i def count2(dna, base): i = 0 for j in range(len(dna)): if dna[j] == base: i += 1 return i def count3(dna, base): match = [c == base for c in dna] return sum(match) def count4(dna, base): return dna.count(base) def count5(dna, base): return len([i for i in range(len(dna)) if dna[i] == base]) def count6(dna,base): return sum(c == base for c in dna) ======================================================================================= Which of them is correct? count 3, and count 6 only count 1, count 3, and count 4 only All of them are correct. count 1, count 3, count 4, and count 6 onlyThe following functions are all supposed to count how many times a certain base (represented as a character variable in Python) appears in a dna sequence (represented as a string variable in Python): def count1(dna, base): i = 0 for c in dna: if c == base: i += 1 return i def count2(dna, base): i = 0 for j in range(len(dna)): if dna[j] == base: i += 1 return i def count3(dna, base): match = [c == base for c in dna] return sum(match) def count4(dna, base): return dna.count(base) def count5(dna, base): return len([i for i in range(len(dna)) if dna[i] == base]) def count6(dna,base): return sum(c == base for c in dna) Which of the correct functions defined in the above exercise is the fastest? Hint. You will need to generate a very large string to test them on, and the function clock() from the time module to time each function. count2 count3 count5 count4
- write a function sequence in Python that accepts an number ( int ) and that prints a sequence of numbers that starts at the given number and obeys the following rules:the number 1 is the last number in the sequence (e.g stop )if the number if even, the next number is half of itif the number is odd, the next number is one moreSpecifications:use a while loopprint each number in the sequence one per line example usage: >>> sequence(3)3421Python Programming- Computer-Assisted Instruction Part 1: Computer-Assisted Instruction (CAI) refers to the use of computers in education. Write a script to help an elementary school student learn multiplication. Create a function that randomly generates and returns a tuple of two positive one-digit integers. Use that function's result in your script to prompt the user with a question, such as: How much is 6 times 7? For a correct answer, display the message "Very good!" and ask another multiplication question. For an incorrect answer, display the message "No. Please try again." and let the student try the same question repeatedly until the student finally gets it right. Part 2: Varying the computer's responses can help hold the student's attention. Modify the program so that various comments are displayed for each answer. Possible responses to a correct answer should include 'Very good!' , 'Nice work!' and 'Keep up the good work!' Possible responses to an incorrect answer shojld…In C++ write a program that generates three random numbers and then find the min number among the generated values, using these three functions: void getrandnum(int &n1, int &n2, int &n3), int findMin(int n1, int n2, int n3), and void printResult(int n1, int n2, int n3, int min). Make the main function drive all these functions.