Dynamin-mediated membrane fission at the plasma membrane is topologically equivalent to vesicle fusion with the target organelle ) vesicle formation into the extracellular space O homotypic vesicle fusion Ovesicle budding off of ER

Q: What are the hormones that the hypothalamus produces?

A: The hypothalamus of the brain contains two sets of neurosecretary cells whose hormonal secretions…

Q: Interferon is a mechanism used to protect the cell that becomes infected with a virus. A. True B.…

A: Interferons are proteins that really can induce non - specific resistance to viral infection by…

Q: Second letter UUU UCU UCC UAU UAC UGU Tyr Phe UUCJ UUA UUG. UCA UCC Ser UAA Stop UGA Stop A UAG Stop…

A: 1)Codon on mRNA strand which codes for Methionine is AUG from 5' to 3' direction. This is an…

Q: Describe the process leading to mast cell activation / degranulation by IgE in type I hypersensitive…

A: Introduction Type I hypersensitivity (also known as acute hypersensitivity) is an allergic reaction…

Q: Two people are 150 m apart and a speaker is placed some distance between them assume all in a line).…

A:

Q: Describe two types of association between proteins and membranes.

A: Introduction:- While membrane lipids provide the basic structure of the lipid bilayer, proteins are…

Q: Explain how mast cells can be activated independently of IgE.

A: Mast cells are tissue-resident cells with a well-defined pathogenic involvement in allergy. They…

Q: Please answer both questions asap. Thank you. - Why would SV40 cause the culturing to occur of HMLE…

A: 1. SV40 three genes encoding SV40 large T antigen , telomerase catalytic subunit and H Ras…

Q: Directions: Answer the questions. Cite your sources to support your given answers. 1. Are pigeons…

A: There are certain similarities in the birds and reptiles which are discussed below. On the basis of…

Q: You are searching for hominin fossils in Africa and discover a skull with a sagittal keel, an…

A: the above characteristics are consistent with a homo erectus skull. 1.the average cranial capacity…

Q: Explain the role of Ras.GTP and Rac.GTP in the formation of active AP-1 during T- cell activation.

A: T cells are produced in the thymus and are primed to recognize a certain foreign particle (antigen).…

Q: Label the visible parts of mung bean and corn seedlings

A: The embryo, endosperm, and seed coat are the three main components of a seed. Before it develops…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: (a) An E. cofi DNA plasmid has 5.64 x 10 base pairs. The plasmid contains a a terminus, and…

A: Answer ::

Q: How does mutation can affect the central dogma and the phenotype?

A: Mutations are the changes in the DNA sequence. The changes can be single base changes or a fragment…

Q: Please associate the source of energy production with the major by-product created for each source…

A: A human body requires an adequate amount of nutrition so as to function properly. The human body…

Q: HIGH TEMPERATURE AND LOW HUMIDITY - BODY EFFECTS 1. dry mucous membranes 2. hyperthermia 3. abrupt…

A: Temperature is a physical quantity that conveys heat and cold as well as a measure of the average…

Q: Muslce tissue contains enough creatine phosphate (CP)  to sustain physical activity for 10 to 15…

A: Muscle tissue is composed of cells that possess the ability to contract to produce movements in the…

Q: In what mechanisms can genetic information be altered? What are the consequences of these changes?

A: Alteration or changes in genetic information is called mutation. Mutation can be spontaneous or it…

Q: Match the structure with its correct body system.   teeth     thyroid     spleen     epididymis

A: Digestive system- teeth  Endocrine system - thyroid  Muscular system- Masseter integumentary system-…

Q: Which of the thousands of unstudiednoncoding RNAs have functions in thecell, and what are these…

A: Noncoding RNAs are RNA sequences that do not code for any amino acids.  They function to regulate…

Q: Name and describe ways that organisms obtain energy and carbon from theenvironment.

A: Introduction: For survival, growth, and development, all living entities require energy. The ability…

Q: Your patient has been poisoned by an unknown substance and shows signs of delirium, abnormal heart…

A: Introduction When an organism is exposed to a sufficient amount of poison, it can cause death,…

Q: A factor to show to effect the acute toxicity for many chemicals in the stomach A Presence or…

A: 9. Sex, epigenetic changes, and polymorphisms in gene products xenobiotic-metabolizing elements…

Q: Generally, polysaccha are not good antigenS, because B cells recognize thei annot get T-cell help.…

A: INTRODUCTION The immune system consists of cells that protect organisms from foreign invaders. This…

Q: A supra-threshold stimulus will induce: A graded potential An action potential of higher amplitude…

A: If any neuron doesn't reach its threshold voltage then there will be no action potential execution.

Q: What is the main function of the Liver of the frog

A: Frogs are predatory, tailless amphibians widespread throughout India. Frogs come in a wide variety…

Q: As a warm-up, draw lines to match the animals with the sensory reception they exhibit. 1. Platypus…

A: Sensory receptors are specialised to receive certain kind of stimulus. Sensory receptors convert…

Q: Antiobiotics should be taken if your child catches a seasonal flu cause by virus? A. True B. False

A: Introduction :- an infective agent that typically consists of a nucleic acid molecule in a protein…

Q: Some bacteria have the ability to survive heat, lack of moisture, cold or acidic  conditions by…

A: Bacteria are prokaryotic microorganisms that is they have a simple cellular organisation with no…

Q: There are 10 E. coli cells in a test tube.  After 4 generations in exponential phase, how many E.…

A: A growing bacterial population doubles at regular intervals. Thus, the E. coli cells grows in a…

Q: The amount of light entering the eye is determined by the size of the: O The pupil O The lens O The…

A: Pupil present in the center of iris .The amount of light entering the eye control by the size of…

Q: What's the difference between homogenous and heterogenous pericarp? I seem can't find the difference…

A: Pericarp is ripened and variously modified walls of a plant ovary and it's composed of an outer…

Q: Discuss the process and pathways of fertilzation in turtles. Also provide or show a diagram how does…

A: In Males there's have one or two penises that pass sperm from their cloaca to the cloaca of a female…

Q: Dual innervation of viscera means: O Visceral organs receive both autonomic and somatic nerve fibers…

A: Dual innervation means innervation from both Sympathetic and Parasympathetic Nervous Systems. Most…

Q: 14.The human axial skeleton includes (This is a multiple choice question choose the answer from the…

A: The bones of human skeleton are divided into two groups the appendicular skeleton and the axial…

Q: Discuss what effective population size (Ne) is , and why is it of importance for conservation…

A: The effective populace size is the size of an optimal populace that would lose heterozygosity at a…

Q: What does CSL Bioplasma do to prevent viral transmission of plasma coagulation concentrates?

A: Answer :: For plasma-derived clotting factor concentrates used in the treatment of bleeding…

Q: how does the flow cytometric osmotic fragility test determine hereditary spherocytosis

A: A condition in which the red blood cells (RBCs) are affected is known as Hereditary spherocytosis.…

Q: Find the flaws! Biodiversity occurs in patterns across the globe. Generally speaking, biodiversity…

A: Biodiversity refers to all the different types of life present in an area. It is the biological…

Q: A python can survive by eating a large meal once or twice a year. When it does eat, microvilli in…

A: Pythons are commonly found in Asia, Africa and Australia. They belong to the Pythonidae which is a…

Q: Workplace Hazards 1. What are the types of environmental monitoring?

A: Environmental monitoring relates to the instruments and procedures used to monitor, characterise,…

Q: The role of the ossicles is to of vibrations Decrease the intensity Increase the strenght O Change…

A: Introduction :- The auditory ossicles are three bones in each middle ear that work together to…

Q: Which symptoms would be present in a case of aldosterone hyposecretion? O low metabolic rate O low…

A: Autonomous aldosterone hypersecretion leads to hypertension and hypokalemia. ACTH means…

Q: receptors have their neurotransmitter binding site and ion channel are components of different…

A: Answer 1: the receptors have their neurotransmitters binding site and ion channels are components of…

Q: Who is responsible for determining the safety andf efficacy of any dietary supplement? A. FDA B.…

A: Introduction Dietary supplements are substances that you can take to enhance your diet or reduce…

Q: Which statements are true? Explain why or why not.1 In terms of the way it interacts with DNA,…

A: Deoxyribonucleic acid (DNA) is an organic chemical that contains genetic information for protein…

Q: Which of these fundamental concepts is well illustrated by genetic exchange among, but distinct…

A: Evolution is the change in the specific features of a species over several generations and depends…

Q: Which statements are true? Explain why or why not.1 A 10–8 M solution of HCl has a pH of 8.2 Most of…

A: Introduction Macromolecules are made up of several large atoms that are linked together. Biopolymers…

Q: In order to insert foreign DNA into a plasmid for molecular cloning, the main components required…

A: Plasmids are small, double stranded, closed circular, symbiotic DNA molecules that occur naturally…

Immune Disorders

The collaboration between the cells and proteins that work together as a defense system against infection comprises the immune system.Each of them performs a variety of tasks to recognize and/or react against a foreign body.