Q: Is the removal of damaged proteins more important than the proper funciton of new proteins? Yes or…
A: Q.Ans:- Explanation:- Damaged Protein:- Damaged proteins can be formed in multiple ways such as…
Q: From a kinetics experiment, Kcat was determined to be 55sec^-1. For the kinetic assay, 0.05mL of a…
A: When the enzyme is saturated with a given substrate then the maximum rate of enzymatic reaction is…
Q: 2. What is the chemical reaction for this process? Fill in the blanks below: C6H₁2O6 + yeast + H₂O…
A: Fermentation is a procedure in which microorganisms use chemical processes to change carbohydrates…
Q: 10. In pea plants purple flowers are dominant to white flowers. If two white flowered plants are…
A: Since you have asked multiple question, Que no.10 and 11 is solved.If you want any specific question…
Q: Describe the process of inserting DNA into a vector
A: The process of inserting a desired fragment of DNA or a gene of interest into a self-replicating…
Q: Subject: Cell Biology Create a SCHEMATIC DIAGRAM of a simple experiment which aims to determine if…
A: The given information describes the synthesis and characterization of ZnO-TiO2 nanophosphors doped…
Q: In which site in the cell does a radiolabeled secretory protein first appear when tissue is…
A: When tissue is incubated briefly with radioactive amino acids, a radiolabeled protein refers to a…
Q: Myotis myotis is to Vespa crabro as Cuculus canorus is to Accipiter nisus True False
A: Arthropods are invertebrates and they belong to the phylum Arthropoda. Arthropoda is the largest…
Q: Identify the feature of the heart labeled "7" in the picture. A Identify the chamber of the heart…
A: The heart is a muscular organ located in the chest that serves as the central pump of the…
Q: ss DNA ds RNA -RT zdsRNA mRNA
A: This image represent Group III class virus (Baltimore classificatio) Group III: Double-stranded RNA…
Q: A genetic autoimmune disease is caused by a single recessive allele a that is located on the…
A: In this genetic scenario, a rare autoimmune disease is caused by a single recessive allele, denoted…
Q: Focus on the change in population from 1990 to 2000. Fill in the blanks with to complete the summary…
A: Population growth explains the increase in the population size or number with time in a given area.…
Q: question: A sustained decrease in MAP could result in decreased release of ACh by preganglionic…
A: This investigation looks at how a persistent drop in mean arterial pressure (MAP) affects the…
Q: Albinism in humans is heritable condition resulting in the inability to produce the pigment melanin,…
A: Albinism is a recessive trait that is inherited from the parents to offsprings. The albinism is…
Q: Which of the following regions of RNAs are translated? a. 5' UTR b. exons c. introns d. 3' UTR e.…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…
Q: In Colony Polymerase Chain Rxn (PCR), how does one determine if the gene of interest is in the wrong…
A: In Colony Polymerase Chain Reaction (PCR), it is important to determine if the gene of interest is…
Q: In certain plants, red flowers are dominant to white flowers. If a heterozygous plant is crossed…
A:
Q: The phylogenetic tree of the OCTN homologs below was generated with the following accession numbers…
A: A phylogenetic tree is an evolutionary tree diagram that depicts the relatedness among organisms…
Q: Question 5 Use the following diagram to answer questions 4 and 5: Chose the appropriate letter. 14N…
A: Production of new DNA from the old DNA is known as DNA replication. In case of eukaryotic cells DNA…
Q: Would this be a scientific hypothesis? Golden retrievers are a better dog for children than…
A: It's vital to see each breed's interesting characteristics, temperaments, and behaviors when…
Q: which of the following can target specific proteins for degredation. - apoptosis - hydrolysis -…
A: Protein degradation is a critical cellular process that regulates cellular functions and maintains…
Q: Set up the square for each of the crosses listed below. The trait being studied is round seeds…
A: Note: Please upload your other questions separately as according to the answering policy the tutors…
Q: One day while walking across campus, you see a female butterfly laying fertilized eggs, as shown in…
A: On a leaf, the female butterfly deposits fertilised eggs, initiating a number of developmental…
Q: The figure below depicts cells from the same organism. Cell B is demonstrating which of the…
A: By multiplying their cell population, organisms may grow and develop due to cell division.…
Q: Silent mutations do not lead to deleterious effects to an organism. Provide examples of when a…
A: It is sudden heritable change in genetic material of organisms. The termn mutation was coined by…
Q: Explanation is greatly appreciated as to identify the chromosomes within the picture.
A: Double fertilization is an unique characteristics in angiosperm that is responsibleresponsible for…
Q: What good things were attributed to being hypermobile, if any?
A: The question relates to the potential benefits related with being hypermobile. Whereas hypermobility…
Q: BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect…
A: Protein Sequence from Step 3: Leu-Thr-Cys-Val-Arg-Gly...Protein Sequence from Step 4 (with the fifth…
Q: 1. You are given a 1 gram soil sample of unknown bacterial load. After doing 10-fold serial…
A: Serial dilution is a fundamental technique used in microbiology to obtain a precise and controlled…
Q: Task #3: Design primers agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61…
A: In molecular biology and genetic research, the design of primers and the incorporation of…
Q: Coated pits" are formed as a result of
A: Coated pits are formed when specific cell surface receptors bind to their ligands, which causes the…
Q: if I have 4 different conditions with 3 replicates what test should I run? I did a lab where I…
A: The statistical method comprehended as analysis of variance (ANOVA) compares the means of various…
Q: Describe the issues associated with drug safety after FDA approval
A: FDA stands for food and drug administration, is a government agency, formed in 1906. This agency is…
Q: How do the antibiotics compare with chemicals in the cure of human disease?
A: Antibiotics are the medications used for the treatment of bacterial infections. However, antibiotics…
Q: What is one major way in which next generation sequencing differs from dideoxy sequencing (Sanger)?
A: The technique of sequencing DNA involves identifying the nucleic acid sequence, or the arrangement…
Q: In posttranslational modification, phosphates are attached to which 3 amino acids? - tyrosine -…
A: Gene is a hereditary unit which is involved in transfer of genetic information. Process of transfer…
Q: (iii) Comment on the passage number of A and B cells. State your reasor (iv) Other than the passage…
A: TERT stands for telomerase reverse transcriptase and TR stands for telomerase RNA. TERT plays an…
Q: 18. How is a nerve impulse transmitted across a synapse from a presynaptic to a postsynaptic cell?…
A: The correct answer to the question is: c. via a neurotransmitter
Q: B) Using the concepts of carrying capacity, population dynamics, and energy pyramids, explain why…
A: Carrying capacity refers to the maximum population size that an environment or ecosystem can…
Q: Explain the advantages of using cell based assays for drug screening?
A: Cell based assay: Cell-based assays are defined as a type of analytical measurement wherein…
Q: What is the specific mode of action and the target organisms of each of the three antibiotics used…
A: Antibiotics can be defined as a chemical substance, released by the microbes and they are harmful or…
Q: Task 4 of 6 (AC 2.1) No more than 200 words for the task A. Label the conductive tissues in the…
A: A fist-sized organ, the heart circulates blood around your body. It serves as the circulatory…
Q: Describe how you can determine if the gene is interrupted and, if so, the number of interruptions by…
A: A method used frequently in labs to separate charged molecules like DNA, RNA, and proteins is gel…
Q: Select one microorganism (a prokaryote, protest, or fungus) which has the potential to be used for…
A: as per our company guidelines we are supposed to answer only 1 question. Kindly repost other parts…
Q: Give typing answer with explanation and conclusion How do vaccines work? Do they work against…
A: Vaccines are biological preparations that stimulate the immune system to recognize and fight off a…
Q: The phosphorylation and oxidative decarboxylation of oxaloacetate by inorganic phosphate (Pi) to…
A: In biochemical processes, the energetics of reactions play a crucial role in determining their…
Q: 1st Bag: shredded wheat original cereal, Warm water, and yeast (no sugar) 2nd Bag: Cinamon Toast…
A: In this experiment, three different bags were prepared, each containing a different type of cereal,…
Q: Many secretory proteins are synthesized as inactive precursors called a. proproteins b.…
A: Secretory protein precursors, also known as proproteins or preproteins, are synthesized in cells as…
Q: Differentiate between hemodialysis and peritoneal dialysis.
A: Dialysis:-Dialysis us a special type of process that removes waste products and also excess fluoid…
Q: which 2 of the following are characteristics of the sodium potassium pump. sel - structure -…
A: Sodium-potassium pump is a transmembrane protein that helps in the transport of Sodium and potassium…
Step by step
Solved in 3 steps with 1 images
- Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. attatatttt atattatata ctctgggctc agagcagccc 40 41 atattatata tatatatttt aaaatattat aaatttattt 80 81 cagtcacgcg tcctgatgac attatatttt ataatttttt 120 121 ttttattttt attatatttt aaaatattat aaatttattt 160 161 aaaatattat tatatattta aaatttattt attataaaat 200 201 aaaatattat ttttattttt gagatcagga cggctgcatg 240 Forward primer Reverse primer5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
- 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.How do you seal sequence 2 (from 5' end) to the 3' end of the sequence 1 in vitro condition? Design a splint oligomer and write the all-possible content(s) needed for reaction to occur. Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3' Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'
- A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein sequences (N-C terminus) using the single letter abbreviations for each 5' GCA UAU CCU UGU GAU 3' B) Identify the two unique amino acids in the protein sequence above, provide their full names and brief explanation why you chose them C) Draw the two amino acids from 3. connected with a peptide bond to each other (with free amino and carboxy termini) at physiological pH|18 Actin can be used as a loading control in a western blotting experiment. What is the purpose of a loading control?Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
- The following RNA: 5' AUGAUAACACUCGUACCUUAAUGU3' in the 5'-3'frame will betranslated into a peptide (use the table): Second letter A U G UAU Tyr UUC (F) UcC Ser UAC (Y) UCA (S)UAA Stop UUU Phe UCU UGU Cys UGC (Č) UUA Leu UGA Stop A UUG (L) UCG UAG Stop UGG Trp G (W) CUU CCU CAU His CGU CUC CCC Pro CÁC (H) CGC Leu САА GIn Arg CGA (R) CUA (L) A (P) CUG CCG CAG (Q) CGG AUU ACU AAU Asn AGU Ser Ile ACC (1) ACA (T) AAA AAC (N) AGC (S) AUC A AUA Thr AGA Arg Lys A AUG Met ACG (М) AAG (K) AGG (R) G GUU GAU Asp GCU GGU GCC Ala GUC Val G GUA (V) GCA (A) GAA Glu GAC (D) GGC Gly GGA (G) GUG GCG GAG (E) GGG G TLRECYH OA MITLVP Stop C OB IKVRLS MITLVP OD. First letter Third letterFor the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG