Q: Which of these is likely to reduce enzyme activity? Increasing pH level II. Decreasing temperature I...
A: Introduction Enzyme activity:- Enzyme activity is the amount of substrate converted by the enzyme in...
Q: Acetylcholine: is the neurotransmitter in the parasympathetic nervous system. is the neurotransmitte...
A: Introduction: acetylcholine is a neurotransmitter, it is an ester of choline and acetic acid. acts a...
Q: An 82-year-old woman is brought to the emergency room complain- ing of nausea, vomiting, muscle cram...
A: Introduction: Hyperkalemia is a condition of high potassium levels in blood.
Q: Simple but creative caption on a poster about noncommunicable diseases caused by having unhealthy li...
A: A non-communicable disease (NCD) is a disease that is not transmitted from one person to another. N...
Q: Mutations that affect organisms are those that involve exons. True or False. Defend your answer.
A: Mutation Sudden heritable change in genetic material or character of an organism is known as mutati...
Q: Hemophilia is caused by an x-linked recessive allele. Make a cross between a hemophilic Father and a...
A: Hemophilia is caused by an x-linked recessive allele.
Q: With over 369,000 species of angiosperms alone, why do you think we get most of our nourishment from...
A: Angiosperms are plants that produce flowers and bear their seeds in fruits. They are the largest and...
Q: What are the 3 phase of the routine stool examination? 2. What would be the pre-analytical phase i...
A: Human feces is known as stool.It is the waste residue of indigestible materials of an animal's diges...
Q: An unknown microbe is found to be able to photosynthesize, but is also able to fix pyruvate for carb...
A: An autotroph is an organism that can produce its own food using light, water, CO2 and other chemical...
Q: 3. Domestic Dog breedni ebsla oslynqonom s svoinos ol Insw eyswis leilemoleye A 4. Felis (Feline; Ca...
A: Cladogram is used to find the branches starting from the ancestral generation till the present gener...
Q: Time Ispods (pill bugs)Temperature(warm) Average(Roaches Temperature(warm) Average(Ispods (pill bugs...
A: Average number of ispods at warm temperatures is very low as compared to ispods at low temperatures....
Q: 30. Which of the following is true? A. Both DNA and RNA contain uracil B. Neither DNA or RNA contain...
A: Deoxyribonucleic Acid - DNA In 1953 to biochemist James Watson of America and Francis of Britain pro...
Q: Describe the mechanism of blood clohing
A: Blood clotting or coagulation is a process of forming blood clots to stop excess blood flow during c...
Q: Illeum (4x) Label : lumen , villa , Peyer's patches of submucosa draw it
A: Small Intestine: Food digestion continues in the small intestine. Pancreatic and liver digestive flu...
Q: QUESTION 17 Neurotranamtes Can induce Ca** flux in a muscie cell and thus muscle contraction are eff...
A: Answer 17) C- neurotransmitters are released at the synapse
Q: A 42-year-old woman consults a dermatologist to evaluate and treat her glabellar lines (frown lines ...
A: The correct answer from the above option is option A.
Q: MDCK cells Jurkat cells 45 sphingolipida/GPL 45 sphngolpds/GPL cholesterolGPL 4. 4. 3.5 cholesteroGP...
A: DRM or detergent resistant membrane is mostly prepared by applying any detergent (such as: Triton X)...
Q: As the number of foxes increases, what happens to the number of mice? O the number of mice stays the...
A: Option B is correct
Q: Identify the method of sterilization/ chemical agent described This chemical agent is used as a sta...
A: Various methods of sterilization have been used in laboratories and pharmaceutical industry.
Q: Describe how Wickens and the Sachs experiments provide evidence for semantic coding in STM and LTM. ...
A: According to Wickens, the subjects were the ones that are presented with some words that are related...
Q: QUESTION 2 Cotransporters... UA Do NOT hydrolyze ATP UB: Include symporters that move ions in the sa...
A: Co-transporters are the membrane carrier proteins comes under secondary active transport of substanc...
Q: Q2. Complete the table below with a tick to show which of the following statements describe the mole...
A: Introduction: Amino Acids are chemical molecules that combine to produce proteins and are hence know...
Q: Create a flow chart on how to prepare a nutrient agar
A: Nutrient Agar ...
Q: Which of these is a tetrapod that is NOT an amniote? A. Ostrich B. Shark C. Rattlesnake D. Salamande...
A: Answer D. Salamander
Q: What would happen to the fox population if most of the mice died from disease? the foxes would eithe...
A: Animal interaction Interaction of different kinds of animals depends upon theirs nature. There are ...
Q: Some plants contain compounds that inhibit serine proteases. It has been hypothesized that these com...
A: Introduction: Tofu, which is also sometimes called tofu cheese is a soya product.
Q: The most useful method for dating ancient calcium rich cave deposits would be Group of answer choice...
A: Answer :- Option (D) is correct. - Uranium-Thorium Dating.
Q: The long hair of Persian cats is recessive to the short hair of Siamese cats, but the black coat col...
A: Introduction A gene is consisting of a pair of alleles/factors and can be dominant or recessive. A ...
Q: A child has a unilateral notch of the upper lip (see image). What is the most likely etiology of thi...
A: The correct option is A.
Q: 1) Interpret the value of the interference. 2) Map the genes
A: The genes that are located on the same chromosome are considered as linked genes. In this condition ...
Q: Phenotype to Population: 1. Describe how the phenotype of individuals with sickle cell disease influ...
A: Sickle cell anemia is an autosome linked (recessive) genetic disorder.
Q: 1. What are the main elements of the lac operon and their functions?
A: NOTE- Since you have posted multiple questions So we will be solving the first question for you. As ...
Q: Which of the following statements about the world population is NOT true?
A: Analysts estimate that the global carrying capacity of the earth is about 50 billion. The world popu...
Q: 7. Use the image to answer the following questions A student collects some of this bacteria to creat...
A: Answer 1:- Based on the microbiological examination of the slide shown in the question, the petri d...
Q: What is the structure of double-stranded DNA as determined by Watson and Crick?
A: In 1953 Watson and cricks realized that DNA is made up of two chains of nucleotide pairs and double...
Q: In the Hershey–Chase experiment, the radioactive label 32P was present inside bacterial cells (i.e.,...
A: DNA is an organic molecule that transmits information from generation to generation. Several experim...
Q: Describe and explain the necessary changes that health systems worldwide must undergo to improve ada...
A: Introduction :- Healthcare system is a system consisting of institutions ( like hospitals, dispensar...
Q: List and explain at least 3 Bacterial infections of the skin
A: EXPLANATIONBacterial skin infection: Bacterial skin infections form when bacteria enter through hair...
Q: cancer theoretical framework 1 Definition of concepts 2 Specification of the hypothesis to be i...
A: The theoretical framework of cancer is the structure that can hold or support a theory of cancer res...
Q: 1) What makes the heart sounds? 2) Know the whole cycle/route that the blood takes from the heart th...
A: 1.Blood does not pass back from the atria into the great veins because the roots of great veins are ...
Q: Which of the following characteristics of a water-insoluble substar nost important in governing its ...
A: Answer C) lipid solubility
Q: Types of homo sapiens
A: Homo is a genus that arose from the (now extinct) genus Australopithecines and includes the extant s...
Q: A certain template DNA strand has the following nucleotide sequence: 3'—TACTGCATAAT...
A: Nucleotides can be described as the nucleic acids’ building blocks. The two forms of nucleic acid th...
Q: State the law of independent assortment in modern terms.
A: Introduction :- According to Mendel's law of independent assortment, alleles from two (or more) diff...
Q: Please explain how different detergents take out proteins selectively out of membrane. (Choose one p...
A: Integral membrane proteins are completely embedded inside the membrane whereas peripheral membrane p...
Q: 23. Which of the following is correct? a) Monomer: Glucose Disaccharide: Glycogen Polysaccharide: Su...
A: Answer 23: Carbohydrates are the sugars that are rich sources of energy. Energy is extracted from su...
Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...
A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...
Q: 4. Ensuring adequate maternal intake of a spe- cific nutrient is especially important in reduc- ing ...
A: The correct option is C.
Q: What are features of nucleosomes ?
A: Nucleosomes are defined as the basic structural unit of DNA packaging in eukaryotes. Under a electro...
Q: d. b. a. ok. C. h. List the names of the structures (A -L) and their primary functions
A: Answer List the name of the structures (A-L) and their primary functions:
Discuss the main physiological function of asthma in detail.
Step by step
Solved in 2 steps
- Explain and provide a treatment for asthma with a particular attention to Pharmacodynamics and Pharmacokinetics.Provide two reason why it is important to follow organisational and legislative requirement for managing asthma conditions.What are the treatment procedure for Chronic Asthma management? Please explain at your own words.
- Define what is understood by the Asthma and briefly describe the pathophysiology of this conditionExplain the postulated mechanisms involved in an (atopic) asthmatic attack. What are the clinical and histological manifestations of an asthmatic attack? What role does chronic inflammation play in perpetuating asthma?Explain the progression of an acute asthma attack to silent asthma by describing how ventilation and clinical manifestations change.