Describe the key characteristics that would allow you to identify or differentiate diatoms, green algae, dinoflagellates, and cyanobacteria.

Q: Using the table below, differentiate the effect of two varying pH levels (as indicated by by the…

A: Enzymes are affected by changes in pH. The most favorable pH value - the point where the enzyme is…

Q: what are evidences that indivate plants are measuring the length of the night?

A: Introduction  The physiological response of organisms to the length of night or a dark period is…

Q: Label the diagram below using the drop down menu provided.

A: The stem of both monocots contains vascular bundles that are made up of xylem and phloem tissues.…

Q: identify the taxonomy of the dinosaur from the skeleton and identify the features or characteristics…

A: Michael Benton classifies all dinosaurs within the Series Amniota Class Sauropsida Subclass Diapsida…

Q: Do you think that Leo needs to drink more water prior to his exercise? Explain why?

A: Dialysis is a technique to eliminate byproducts and excess liquid from the blood when the kidneys…

Q: If a small part of the cell membrane surrounds a molecule so that it can enter a cell, then the…

A: Cell membrane, also called plasma membrane is the thin membrane that surrounds every living cell,…

Q: Question 4 of 25 Use the diagram to answer the question.     Some organisms use a single loop…

A: The single loop heart is found in lower organisms (fish), in which the blood pressure and oxygen…

Q: GUIDE QUESTIONS: 1. Identify the fixation and embedding protocols of seed tissues for microtome…

A: Microscopes are extremely significant equipment that is mostly utilized in the field of science. The…

Q: Urinary system lab assignment and related case study Leo, 37-years old was absolutely shocked when…

A: Introduction The kidneys, ureters, bladder, and urethra make up the urinary system, often known as…

Q: Proteins occurring in the b-pleated sheet structure Multiple Choice are relatively inelastic.…

A: INTRODUCTION Beta pleated structure of protein This contain beta strands held together by two or…

Q: Describe the properties of the genetic code - how many codins code for amino acids, stop colons,…

A: The genetic code can be defined as a set of specific rules for a living cell to translate…

Q: Complex III delivers 4 protons. Where do these 4 come from UQH2 mitochondrial intermembrane space…

A: Introduction :- The electron transport chain's Complex III, also known as Q-cytochrome c…

Q: Fruit flies infected by fungi are protected by drosomycin and when infected by bacteria are…

A: Drosomycin is a peptide against the fungus infectant when it infact the Drosophila melanogaster or…

Q: In case of a plant virus going viral, what actions do you think should be made to improve our food…

A:

Q: A dominant allele that arises from recurrent mutation is mildly deleterious. The fitness of…

A: A mutation is a change in an organism's DNA sequence. Mutations can occur as a result of errors in…

Q: design a bacterial/archaeal species, what would be its characteristics (e.g. shape, arrangement,…

A: Bacteria are small unicellular microorganism that lacks any proper cell organization (which means no…

Q: 22. It is a microbial infection of the bladder. 23. It is the infection of the renal pelvis. 24. It…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: Explain what impact a blocked gall bladder duct would have on digestion.

A: Introduction Gallbladder:- It is a small, pear-shaped organ on the right side of your abdomen, just…

Q: Which suspect is the perpetrator of this crime? Explain the results you see in the DNA gel Why each…

A: From the STR analysis we found that the DNA of CS and DNA of individual C will give the bands in the…

Q: True or False: 1. There is the bidirectional mode of replication during S-phase.  2. Single strand…

A: The replication is the process of new DNA synthesis from the old DNA template by semiconservative…

Q: What could be the effect of Isthmus of Panama to marine and terrestrial organisms in North and South…

A: Introduction The Isthmus of Panama also historically known as the Isthmus of Darien, separates the…

Q: During DNA replication, the enzyme called _______ unwinds the DNA do

A: The helicase enzyme unwinds the DNA double strand helix by breaking the hydrogen bonds present…

Q: What is composite materials? Describe biomass derived composite materials by picking one biomass.

A: INTRODUCTION Biomass refers to the mass of living beings such as plants, animals, and microbes, as…

Q: Pick the best answer choice from below:

A: During oxidative phosphorylation a total 2.5+1.5=4 molecules of ATP produced in one round. The NADH…

Q: Did you have an experience when a stranger acted caring and was helping you? What impact did that…

A: Empathy creates a connection that enables us to feel compassion. We can sense the suffering of…

Q: Which of the following images shows a phage with a Siphoviridae morphotype? A) B) C)

A: Siphoviridae viruses are double stranded DNA viruses which belong to order Caudovirales. this family…

Q: In which era of the Geologic Time Scale are we currently living ir O Cenozoic O Mesozoic

A: 2nd answer is cenozoic

Q: Give the number of cleavage of uvarovite, grosullar, and andradite?

A: Garnet is a mineral group made composed of many closely related minerals. Garnet minerals share…

Q: 1. What is a microtome? Write four types of microtomes and their uses. 2. What are the steps to…

A: We are allowed to do upto three subpart of a question. Please repost the undone question again.…

Q: Crossing over gives genetic and happens during the stage of meiosis I.

A: Cell division happens when a parent cell divides into two or more daughter cells.  There are two…

Q: what is/are the importance of the sense and missense/antisense strands and 2. what are the…

A:

Q: What cellular event happens in response to the binding of a growth factor to its respective receptor…

A: As per our company guideline we are supposed to answer only first question or first 3 subparts of…

Q: identifying the type of bacteria I have cultured. I know that it is gram-negative and cocci in…

A: There is only two type of bacterias which do not grow so well on EMB medium.  1. Shigella    2.…

Q: Discuss the physical structure of either a forest or a lake, and explain how the physical structure…

A: Lake is an open body of shallow depression containing water usually freshwater. Different types of…

Q: The concept that traits in parents are mixed together to form an intermediate condition in their…

A: Answer : Option (2) is correct. - blending inheritance.

Q: Differentiate flexion from torsion. Why do these events occur in the developing embryo?

A: Answer--

Q: how the genes are related to intellectual disability in details

A: Answer :- As we know that incorporates Fragile X disorder (FXS), the most well-known acquired type…

Q: This process happens in the thylakoids. " O Light Reaction O Calvin Cycle O Both Light Reaction and…

A: Ans: Thylakoid is an membrane bound structure found in chloroplast and cyanobacteria. It is arranged…

Q: cycle was thể first etabolic cycle to be Vered, predating the description of the citric cle by 5…

A: Urea cycle began inside the mitochondria of liver hepatocytes but three of the steps occur in the…

Q: Canthium wenzelii and Canthium sp. What will happen to the two Canthium species, which have their…

A: In phylogenetic studies, the most suitable method to visually represent the evolutionary…

Q: 1- Why was the T4 and E.coli mixed together in top agar and then poured on the plate instead of just…

A: T4 bacteriophage and E. coli mixture using in plaque assay :-

Q: Review Activity - Unit 10: Evolution 1. are traits that help an organism survive and reproduce in a…

A: Evolution is the change in the heritable characteristics of biological population over successive…

Q: 4. 16B (Eukaryotes): Describe 4 factors that differentiate eukaryotic chromosomes/genome from a…

A: Nucleus is a chief controller of the cell which carries genetic instructions . It comprises of…

Q: With a diagram trace the movement of electron during the LRP of photosynthesis.

A: Photosynthesis is a process in which carbon dioxide and water is used up as raw material along with…

Q: Why the synergy test results demonstrated that Penicillin G and Gentamicin did not act…

A: In the development of antibacterial drugs, when two or more drugs are tested together…

Q: Give the economic and ecological importance of Sugar cane (Saccharum)

A:

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: A hypothetical population was found to have a genotype frequency of AA=20%, Aa=40%, aa=40%.  What…

A: Hardy-Weinberg provides the null hypothesis that links the alleles and the genotypes in the…

Q: ! Discuss, the adaptations that Plasmodium falciparum (Protists) has evolved to invade and…

A: Plasmodium falciparum is a parasite that affects human and worsen of this causes malaria in human…

Q: Name and describe the main fuctional macromolecule found in red blood cells

A: Blood is made up of liquid and solids. The liquid part, called plasma, is made of water, salts, and…

Immune Disorders

The collaboration between the cells and proteins that work together as a defense system against infection comprises the immune system.Each of them performs a variety of tasks to recognize and/or react against a foreign body.