Degeneracy of the genetic code denotes the existence of which of the following? A. codons that can wobble at the 5' position B. multiple codons for a single amino acid C. codons consisting of only two bases D. base triplets that do not code for any amino acid E. codons that are not overlapping

Degeneracy of the genetic code denotes the existence of which of the following? A. codons that can wobble at the 5' position B. multiple codons for a single amino acid C. codons consisting of only two bases D. base triplets that do not code for any amino acid E. codons that are not overlapping

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 4TYU: The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA...

See similar textbooks

Related questions

Q: Which of the following describes the interactions between a codon and an anticodon? A. A codon and…

A: Codon is in mRNA (messenger RNA) and anticodon is in tRNA (transfer RNA).

Q: Explain why cell biologists predicted that the genetic code would be based on a 3-base codon.…

A: The genetic code is the precise sequence of DNA nucleotides read as three-letter words or codons…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:

A: This question is based on the functioning of mRNA expression.

Q: Which of the following best describes mRNA? Group of answer choices a) Complexes with ribosomal…

A: RNAs are produced as a result of transcription process.

Q: Which statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino…

A: 3 nucleotides ( triplet ) formed a single codon . Each codon code for specific amino acid . There…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would…

A: The correct answer is C) A-A-A-A-A; nucleus .

Q: The fourth codon in an mRNA sequence is GGG, which specifies glycine. If we assume that no amino…

A: Translation of messenger ribonucleic acid (mRNA) into amino acid begins at the 5' end and stops at…

Q: amino acids are covalently linked to tRNAs via what a) phosphodiester bond b) premature…

A: Protein synthesis is governed by the genes which are present on the chromosomes. The genes are first…

Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…

Q: Which of the following best describes tRNA? a. Provides the instructions for the amino acid…

A: Translation is the process of formation of amino acids from mRNA sequence.

Q: What is the correct tRNA anti-codon sequence for the AUG mRNA sequences? a. UGA b. UAC c. CAU d.…

A: Transfer RNA (tRNA) is a small RNA molecule that plays a key role in protein synthesis.

Q: The wobble position of codons occurs A. before the 2nd base B. after the ribosome initiates a stop…

A: Question - The wobble position of codons occurs A. before the 2nd base B. after the ribosome…

Q: Exon shuffling is a proposal that relates exons in DNA to the repositioning of functional domains in…

Q: What is the genetic code? a. The relationship between a three-base codon sequence and an amino acid…

A: Translation is the process of conversion of an mRNA (messenger RNA) molecule into a functional…

Q: Which of the following statements about the genetic code are true and which are false? Correct each…

A: Genetic code is the sequence of nucleotides in the mRNA that determines the sequence of amino acids.…

Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus? In other words,…

A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…

Q: The fourth codon in an mRNA is GGG, which specifies glycine. If we assume that no amino acids are…

A: Codon refers to a set of three-nucleotide sequences, which codes for a specific amino acid. The…

Q: Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that…

A: Introduction: DNA is a hereditary material that transfers from one generation to another. It is a…

Q: explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: What is the rationale for the hypothesis of the genetic code

A: The genetic code is a set of rules that living cells use to convert information encoded in genetic…

Q: Suppose that section x, y, and z of the following hypothetical DNA strand are the exon (coding…

A: Exons and introns are nucleotide sequences within a gene. Exons are the coding sections of a gene…

Q: Which of the following is a characteristic of the genetic code? a. codons and anticodons consist of…

A: Genetic code is considered as the base triplet code, which poses 3 nucleotide bases. These codons…

Q: Define the following terms: a. wobble hypothesis b. aminoacyl-tRNA synthetase c. tRNA d. AUG…

A: Wobble hypothesis was proposed by scientist Crick mainly to explain the observed degeneracy in the…

Q: How many mRNA nucleotides does it take to code for a polypeptide that is 30 amino acids long?…

A: on the mRNA, we have codons that code for very specific amino acids. we have 61 codons that code for…

Q: A missense mutation is a mutation in which: a. one nucleotide in a codon is changed, but the codon…

Q: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains…

A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…

Q: A small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA…

A: Introduction A silent mutation is a kind of point mutation where the mutation does not affect the…

Q: A codon is a. one of three nucleotides that encode an amino acid. b. three nucleotides that encode…

A: DNA is transcribed into mRNA. mRNA has codons which are translated into amino acids. Every codon…

Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!) tRNA anticodon (No thymine in…

A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…

Q: Suppose that codons consisted of 4 nucleotides instead of 3 and that there were only 2 different…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Use the chart here to answer the following question. Second Base in Codon U A G UUU) UCU UAU] UACTyr…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: double-stranded helix

A: After mRNA synthesis there are post transcriptional processes which converts the heterogenous…

Q: Which of the following is an example of the degeneracy of the genetic code? Group of answer choices…

A: Answer of the question given below...

Q: In a polyribosome, the polypeptides associated with which ribosomes will be the longest? a. Those at…

A: Ribosomes are involved in translation by building proteins from amino acids using messenger RNA as a…

Q: If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…

A: An mRNA directs the insertion of single amino acid to a protein per three nucleotides. A codon is a…

Q: Following transcription, the RNA has a complementary sequence of which of the following? Question 9…

A: The process of copying of DNA segment onto an RNA using enzymes and nucleotides is called as…

Q: The genetic code is said to be degenerate, which means that: A An anticodon can interact with more…

A: There are only 20 essential amino acids that needs to be synthesized during formation of a…

Q: Describe the specificity between the amino acid carried by a tRNA and a codon in mRNA.

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Which mutation changes a normal codon to another codon specifying the same amino acid a. directed b.…

A: Any change in the base pair of the sequence of base pairs that are present in the nucleic acid…

Q: Which mutation changes a normal codon to another codon specifying the same amino acid a. directed b.…

A: In missense mutation codon for an amino acid gets replaced. Then option b is wrong.

Q: Explain the reasoning establishing that a sequence of three nucleotides (a triplet codon) is the…

A: The nucleotide can be defined as the basic building block of nucleic acids. RNA and DNA can be…

Q: Which of the following BEST describes the characteristics and function of siRNA? A. a short strand…

A: siRNA or short interfering RNA or silencing RNA is a class of double stranded RNA molecules which…

Q: A codon is: a. a series of consecutive genes b. three nucleotides that specify an amino acid C. the…

A: Given: A codon is.

Q: Which of the following statements are accurate descriptions of the genetic code? MARK ALL THAT APPLY…

A: Transcription is the process in which the mRNA copied information from DNA for protein synthesis.…

Q: What characteristic of the genetic code explains why a substitution mutation in a codon contained…

A: Codons are sets of three nucleotides responsible for the detection by tRNA for the type of amino…

Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…

A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: Such as in the case of sickle-cell disease, which of the following can occur from the mutation of…

A: Gene mutation is the change in expression of a gene which is caused by change in a single base pair…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Degeneracy of the genetic code denotes the existence of which of the
following?
A. codons that can wobble at the 5' position
B. multiple codons for a single amino acid
C. codons consisting of only two bases
D. base triplets that do not code for any amino acid
E. codons that are not overlapping

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction: -

VIEW

Step 2 Explanation: -

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
Each combinations of nitrogen bases on the mRNA molecule is a codon, which is a three letter code for a specific amino acid. The table shows the mRNA codon for each amino acid. Use the genetic code table to answer the questions. 4. The codon for tryptophan is? 5. For leucine, there are __ different options. 6.The codon GAU is for ____7. In a stop codon, if the second base is G, the first and third bases are __ and __
Explain in one statement/phrase why the base sequence ATC could not be a codon.
Explain the degeneracy of the genetic code. What is the wobble in codon-anticodon recognition
A mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon and resulting in shortened procollagen. Consult the genetic code and suggest one way that this can happen.
Use the table of the codons to answer the following question. Starting with the start codon, what is the sequence of the peptide that translated from the mRNA AGAUGAAAGACGCGCUAUUGUGACGU Arg Lys Thr Arg Tyr Cys Asp Arg Met Lys Asp Ala Leu Leu Asp Lys Gln Ala Ile Val Ser Cys O
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? a. complementarity b. nonsense codons c. universality d. degeneracy
Explain the relationship between codons, anticodons, and amino acids. Be sure to define each and use an example in your explanation.
Given the sequence of one DNA strand (5'-3' or 3' to 5'), a mRNA, or a set of tRNAs, know how to deduce the other sequences from them. Also, given a codon table, know how to determine the specified amino acid or stop codon from mRNA and/or tRNA sequences.
Explain the reasoning that established a sequence ofthree nucleotides (a triplet codon) as the basic unit ofthe code relating DNA to protein.
Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of mutation and explain what will happen to the organism. You may choose which base to alter. Please provide the new amino acid sequence with each mutation. 5’ AUGCCUACGGACUGGCCU 3’ (Met/Pro/Thr/Asp/Trp/Pro) Use the following codon chart to help you show the translation of each sequence. a. Frameshift Mutation : b. Missense Mutation : c. Silent Mutation : d. What is the anticodon sequence of the original amino acid?
The sequence below represents a strand of mRNA. Draw a box around the start codon. Then use the codon table provided, translate the mRNA and write the amino acids that are coded for. Remember that the start codon also codes for an amino acid. Stop at the stop codon. There is a stop codon. If you don't find a stop codon, you've missed something important. UAUG CAUG GUUA AUC