define the term science

Q: The kidney is a target of several complicated pathways, but the effects can be summarized as the…

A: Introduction: Two bean-shaped organs, the kidneys are each roughly the size of a fist. One is on…

Q: Write 5 strategies to make classroom and play ground healthy, safe and active spaces.

A: Introduction Being in the 21st century it is important for making the students ready for future…

Q: Rank the relative size of the gametophyte generation in the following plant lineages: Bryophyte…

A: Plants show alternation of generation where they complete their life cycle in two phases - a diploid…

Q: Consider a locus with two alleles (b1 and b2) in a population of bacteria (bacteria are haploid).…

A: The Hardy-Weinberg principle is also known as the Hardy-Weinberg equilibrium or law in population…

Q: 1. Determine the inactivation rate constant (K) for a microorganism for the following treated…

A: The inactivation of microorganisms in a disinfection plant is determined by the length of time the…

Q: What are the functions of saliva?

A: Saliva is a clear liquid secreted by the salivary glands present in the mouth region. The saliva…

Q: 1. The antibacterial activity of flavonoids was tested against the bacterial strain, Escherichia…

A: As per our guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…

Q: Which coenzyme is not a Pyruvate Dehydrogenase Complex (PDH) requirement? O a. thiamine…

A: Introduction Coenzymes are non-proteinaceous substances that are essential for enzymes and increase…

Q: Are the Sweet potato and Potato homologous or analogous? What type of evolution has brought such a…

A: Introduction :  In biology, evolution is the alteration in a species' traits over a number of…

Q: Which of the following is NOT true of stabilising selection a. it occurs when inidivuals with…

A: Introduction EVOLUTION : The series of events that occurs from the generations to generations for…

Q: When the skin is exposed to sunlight it will produce: Calcium Vitamin D Vitamin C Vitamin D…

A: Vitamins are essential constituents of food other than carbohydrates proteins and fats required in…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: During pregnancy, FSH and LH levels should be: High-progesterone stimulates the release of FSH and…

A: Luteinizing hormone (LH) and follicular stimulating hormone (FSH) are released from the anterior…

Q: What vaccines are available to prevent viral hepatitis?

A: Introduction Hepatitis virus as the name suggests affects the liver, Hepatocytes, and itis means…

Q: Select your "favorite" bone in the human body or one you find interesting and then identify whether…

A: The skeleton system in an adult body is made up of 206 individual bonds. The endoskeleton is…

Q: By what mode of cell division would you expect sperm cells to be formed in the haploid male bee?…

A: Cell division occurs when a parent cell divides into two or more daughter cells. Cell division is…

Q: In some organisms, asexual reproduction can occur from just a fragment of the parent organism,…

A: Asexual reproduction is a type of reproduction in which new offsprings are produced from a single…

Q: The following diagram shows two pairs of homologous chromosomes. One pair of homologous chromosomes…

A: The sexually reproducing organisms produce gammates that are the unit of sexual reproduction. The…

Q: Can you show me the cross and how to get the answers

A: The leaves of the 4-o'clock plant might be green, variegated (white and green), or white. Different…

Q: The light compensation point of a sun leaf is higher or lower than a shade leaf? Higher Lower

A: Light compensation point ( LCP )  LCP  is the point on the light curve where the light intensity at…

Q: Julie (a female) has hemophilia. Based on this information, what can we say about the genotypes of…

A: Introduction X-linked diseases are those that occur due to the presence of abnormal/ diseased…

Q: If the line 3 butterflies are crossed with the line 5 butterflies and they produce all extra-long…

A: During the genetic crossing, the parents give rise to their offspring. The offsprings have a…

Q: How many lions do you think there are in 1960 and in 1975?

A: There is continuous drop in lion population and experts estimates that the total population of lions…

Q: Discuss how assortative mating can influence genotype frequencies. Are there any potential…

A: Introduction Assortative mating sometimes referred to as "non-random mating" is a type of sexual…

Q: Sugars starches and cellulose are all types of

A: Macronutrients are nutrients which our body needs in large amounts. These include - carbohydrates,…

Q: A Senecio lautus population growing on a headland has a prostate form, growing low to the ground,…

A: A Senecio lautus is a  flowering plant species in the daisy family. The two main populations of this…

Q: if there are 1,000,000 bacteria and 90% of them are killed, how many bacteria remain?

A: Bacterial growth is an orderly increase in the quantity of cellular constituents and number. It…

Q: origin and fate of the progenitor cells of the LGE and which type of migration do these progenitor…

A: LGE or lateral ganglionic eminence along with the MGE or medial ganglionic eminence form the basal…

Q: i. Tabulate the parts and functions of the microscope

A: Introduction  A laboratory tool called a microscope is used to examine specimens that are too small…

Q: Lungs contain more elastic fibers than collagen fibers.

A:

Q: Complete the chart below to indicate which occurrences would provide barriers sufficient for…

A: Interbreeding It refers to the breeding of organisms with another organism of different species.…

Q: List the events occur at the neuromuscular junction.

A: Introduction The NMJ or the neuromuscular Junction is the site of synaptic connection between the…

Q: DNA Sequence mRNA Sequence (codon) tRNA Sequence {anticodon) AMINO ACID Sequence

A: Introduction DNA (Deoxyribonucleic acid)serves as the genetic material of almost all organisms (some…

Q: identify the following genetic terms in order from smallest to largest. Gene - Nucleotide -…

A: Cell growth and division is mainly regulated by the nucleus of the cell. This nucleus contains…

Q: What is esophageal atresia?

A: Esophageal atresia is a congenital birth defect of the esophagus that is swallowing tube that…

Q: What are ribosomes? State the function of ribosomes. In what way eukaryotic ribosomes differ from…

A: A subfield of biology called cell biology examines the composition, operation, and behavior of…

Q: What are the genotypes of individuals 1, 2, 4, and 7? 9 OLOT 12 10 11 13 14 15

A: This a hungtingtons disease pedigree chart. Because of affected female are present. Using different…

Q: What is the most common cause of liver cancer?

A: A tumour that can develop anywhere in the liver is called liver cancer. On the top right side of…

Q: is a substance secreted by cells in the lungs that reduces surface tension.

A: Lung surfactant is a complex with a unique phospholipid and protein composition. Its specific…

Q: What are the three phases of hepatitis viral infection?

A: Hepatitis caused by a viral infection damages and inflames the liver. Hepatitis is brought on by a…

Q: Why does inflammation occur with contact dermatitis?

A: The clinical definition for skin inflammation is dermatitis (irritation). An allergic or irritating…

Q: What is the effect of aSN oligomers on the vesicles? alo ant video on the PC creen

A: Introduction Alpha-Synuclein(αSN or ASN) is a protein(140 amino acids) expressed in the Central…

Q: Compare herpes zoster and varicella.

A: Herpes zoster is just another name for shingles. The varicella-zoster virus causes both shingles…

Q: Identify a fact about the urinary OR endocrine system (disorder, anatomical structure). Describe…

A: Introduction Glands are a group of cells that produce and secrete enzymes or hormones. Glands are…

Q: a. Make a Venn Diagram to differentiate the exclusive and common organelles in both plant and animal…

A: A subfield of biology called cell biology examines the composition, operation, and behaviour of…

Q: Identify a cardiovascular disorder. Describe that disorder in terms or cause and some typical…

A: According to our guideline we can't mention the sources of the answer. There are different types of…

Q: What are ribosomes? State the function of ribosomes. In what way eukaryotic ribosomes differ from…

A: A subfield of biology called cell biology examines the composition, operation, and behaviour of…

Q: A. Observe the frog ovary and take note of the following structures: theca interna, theca externa…

A: Ovary This is a reproductive hormone where eggs are formed. There are a pair of ovaries present in…

Q: Which statement best describes how diving mammals are different than mammals that are not adapted…

A: Introduction :- Warm-blooded creatures known as mammals have three middle ear bones, sweat glands,…

Q: What is the map distance between the two rapid lysis mutations re and r' given the data below? 2…

A: In the question given that, re- rf- X r+ Large plaques= 5200 Small Plaques= 4800 Out of the total…

Intelligence

Intelligence refers to the intellectual functioning that compares a person's intelligence quotient (IQ) with other people of the same age. In other words, it is the ability to understand circumstances or situations and arrive at appropriate solutions. Both animals and plants exhibit intelligence.