d. Much of the experimental research on the propagation of nerve signals has focused on an especially large axon found in the squid. The axon's Nernst potential for K+ ions is -115 mV at a temperature of 15°C. The ion concentration outside the axon is 2.0 mM. What is the concentration inside the axon? 0.02 mm mM
Q: 1.a)Which statement is correct with respect to eggs? The white of an egg has about equal quantities…
A: Proteins are complex macromolecules that play a central role in the structure and function of all…
Q: n a-c below, will the residue on the right-hand side increase or decrease the pKa of the residue on…
A: Amino acids that do not have ionisable side chains are zwitterion at neutral pH since they have an…
Q: Determine the amount of glucose in the unknown sample by plotting a standard curve of Absorbance at…
A: Here we are conducting an assay to determine the amount of glucose in an unknown sample. For this,…
Q: Give one example of a disease related to heart and briefly explain the molecular basis of the…
A: The human body, just like any other complex lifeform (or even simple lifeforms ) functions as a…
Q: What do vaccines introduce into the body? short chain fatty acids antibodies lymphocytes phagocytes…
A: vaccines are biological preparations that help to stimulate an individual's immune system to produce…
Q: Briefly describe why mammals can not convert fatty acids to carbohydrates? Why plants can do so?…
A: Lifeforms are more or less a controlled and well regulated chemical lab in themselves. A whole lot…
Q: Which of the following is NOT a true statement about the diagram below? Intermediate A Pathway…
A: Enzymes are the biocatalysts that mediate the biochemical reactions of metabolic pathways. They have…
Q: 1. Hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase is 99% complete at…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: UDP-glucose pyrophosphorylase catalyzes the removal of a pyrophosphate group from UTP as it…
A: In glycogen synthesis the formation of uridine diphosphate (UDP) glucose is done by UDP glucose…
Q: If you wanted to estimate the molecular weight of a newly isolated protein (no known amino acid…
A: If you want to estimate the molecular weight of a newly isolated protein with no known amino acid…
Q: The concentration of protein in a solution can be determined via UV spectroscopy and colorimetry*…
A: UV spectroscopy UV spectroscopy is a technique which uses the absorption of ultraviolet radiation by…
Q: 1. Bacteria have a membrane potential, although the mechanisms of how it is maintained differ from…
A: To calculate the number of positive ions needed on the exterior surface of the bacterium to…
Q: Experiment A. You replace spiperone with a radiolabelled drug that has a higher affinity for the D₂…
A: The log dose-occupancy curve is a graph that shows the relationship between the concentration of a…
Q: What are the vitamin derivatives of the following A. Nicotinamide coenzyme B. Flavin coenzyme C.…
A: Vitamins are the organic compounds that are vital for the health of an individual. Vitamins are…
Q: here is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Please draw the all-atom…
A: DNA contains nitrogenous bases A, T, G and C while RNA contains A, U, G and C. RNA is synthesised…
Q: Describe 3 Application of AI in Medicine
A: AI stands for artificial intelligence. Nowadays AI is used widely in every sector including…
Q: A patient receives an intravenous (IV) solution that flows at the rate of 150 mL per hour. How…
A: The intravenous solution is the fluids or any medicine that is directly given into the vein. It…
Q: 10. Coenzyme used in electron transport. 11. It contains an apoenzyme and a metal ion cofactor. 12.…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: It is a pyrimidine derivative that does not form part of nucleic acids.... A) Thymine B) Cytosine C)…
A: Nucleotides are the building blocks of nucleic acids. They are phosphoric acid esters of…
Q: Which of the following substances is involved in de novo synthesis of purine nucleotides but not…
A: Metabolism is the sum total of all chemical transformations taking place within an organism. Most of…
Q: A ________ is a recognizable folding pattern involving at least 2 secondary structures and the…
A: Proteins are primarily synthesized as a linear chain of amino acids linked together via peptide…
Q: In experiment,how would you approach determining the potency of an agonist to the D2 receptor?
A: Dopamine is a neurotransmitter, a chemical messenger that plays a role in a variety of physiological…
Q: rue or false 1. Cytochrome p450 is considered to be the “universal oxygenase” 2. In alzheimer’s and…
A: Oxygenases are enzymes that oxidise substrates with molecular oxygen. PD and AD are neurological…
Q: The aromatic side chain of Trp residues in proteins and peptides can be chemically modified by two…
A: Amino acids are classified as acidic, basic, hydrophobic and polar neutral based on the nature of…
Q: 1. Which of the following statement is correct? a. Lipids can only participate in the TCA cycle. b.…
A: Metabolism of biomolecules is a interrelated process. The end product of one metabolic pathway can…
Q: The acronym DFR stands for what?
A: Biomolecules often have long complex names. The use of acronyms helps us simply the name of complex…
Q: The unicellular fungus Saccharomyces cerevisiae is used in the food industry to ferment sugars. The…
A: In animals, Pyruvic acid has two possible fates in the cell: be oxidised into acetyl CoA and enter…
Q: Ingredients: Ham, Swiss cheese, artisan stone-milled rye bread, tomatoes, red onion, lettuce,…
A: INTRODUCTION : Carbohydrates : They are organic compounds also known as long chain sugars which are…
Q: 1. If the hydrophobic solvent hexane (C6H14) was the "solvent of life", predict the following and…
A: The structure of biological macromolecules is determined by noncovalent interactions like…
Q: These functional groups act as acid/ base catalysts: A. His imidazole B. Thiol of Cys C. Guanidino…
A: Acid base catalysis is most common type of catalysis mechanism utilized by most of the enzymes like…
Q: Sulfur compounds give onions their unique flavor and properties. Compound 1 is the starting material…
A: Allinase is an enzyme which catalyzes a biochemical reaction in which S-alkyl-L-cysteine S-oxide…
Q: What is the total number of H+ transferred from matrix to intermembrane space of the mitochondria by…
A: Complex I, II, and III are the part of the electron transport chain or oxidative phosphorylation.…
Q: In determining the activity of an enzyme of choice, which do you prefer, monitoring the product…
A: Enzymes are biological catalysts that enhance biochemical reactions in living organisms. The…
Q: 3. A. Briefly discuss the four levels of structure in proteins. Knowing that the 3-dimensional shape…
A: Protein is a polypeptide made up of amino acids. The sequence of amino acids determines the…
Q: Question 1 Amyloid Precursor Protein (APP) is actually thought to be a natural neuroprotective agent…
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: Erythropoietin (EPO) is a glycoprotein hormone that stimulates the production of erythrocytes in red…
A: Glycoproteins are proteins which contain oligosaccharide chains (glycans) attached to amino acid…
Q: Question 22 Which is not a structural motif for DNA binding? αβα motif Zn Finger leucine zipper…
A: Proteins are true polymers, which are composed of amino acid units. Proteins have four levels of…
Q: Some scientists debate whether it is correct to consider pyruvate as “the end of glycolysis”.…
A: Introduction All living organisms require energy. They get energy from cellular respiration.…
Q: FoF1 ATPase is the enzyme that catalyzes ATP synthesis. The enzyme itself is deactivated. ATP. What…
A: Enzymes are biological catalyst that speed up biochemical reactions. Activity of enzymes refers to…
Q: Give the molecular and structural formulae for: –2 examples of structural isomers of monosaccharides…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Serine proteases are involved in the control of blood coagulation, fibrinolysis, complement…
A: Serine proteases - are enzymes which cleaves peptide bond by formation of catalytic triads and Ser…
Q: Part Three: Metabolism: Your cells are going to USE the food they've been provided! Describe the…
A: Metabolism is the chemical reactions occurs in our body which changes the food into energy to run…
Q: 1. In the figure shown, identify what is labeled by the letter C. * A 0- D 0=P-O-CH₂ сн, В 0- Ribose…
A: Nucleotides are phosphoric acid esters of nucleosides. They are the building blocks of nucleic…
Q: Why was it necessary to use phosphoaminophosphonic acid-adenylate ester (ANP) in the ATP synthase…
A: As per the chemiosmotic Model, ATP synthase is the enzyme that phosphorylates ADP with Pi as…
Q: DNA MELTING Two antiparallel single strands form a DNA duplex according to the following model: SA…
A: Gibbs's free energy, also known as free energy or G, is a thermodynamic quantity that represents the…
Q: Uracil and Adenine are two nitrogen bases constitutive of RNA. Both compounds show maximum…
A: The Beer Lamberts equation relates the absorbance value given by an analyte for a particular…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: What is the main source of energy for ATP replenishment for ATP-PC system
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…
Q: Rationalize the use of all the reagents used in Agarose gel electrophoresis.
A: Agarose gel electrophoresis is a technique used to separate nucleic acids based on the size. The…
Q: Draw the structure of the a-keto acid formed by the transamination of each amino acid: (a) tyrosine…
A: Transamination is a type of reaction in which, the amino group of an amino acid is transferred as a…
Nernst potential (V) can be calculated using following equation
V = RT/zF ln (Xout/Xin)
where V is equilibrium electrical potential difference
R is Gas constant
T is temperature (K)
z is ion charge
F is Faradays constant
Xout is ion concentration outside
Xin is ion concentration inside
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 3) You are investigating the ionic selectivity of an ion channel opened by activation of a specific group of ionotropic receptors. You use the ionic concentrations shown in the following table and determine that the reversal potential for activation of the receptors is -10 mV? Ion Intracellular (mM) Extracellular (mM) Equilibrium Potential (E1on) K+ 140 5 Na+ 10 145 Ca2+ 0.0001 2 Cl- 6. 106 a) Use the Nernst equation to calculate the equilibrium potential for each ion above. b) Is it likely that ion channel is selective to a single ion? Why or why not? c) Provide one possible ionic selectivity for this channel that could give rise to the following reversal potential. d) How would you determine if this possibility is correct?Three currents are produced by a 56 mV depolarization leading to an action potential in a squid axon membrane during a voltage clamp experiment as shown. What is the mechanism underlying the capacitive current? 56 mV Depolarization Capacitative current Late current Early current Time (ms) Opening of Na* channels Current due to the Na/K* pump O Neutralization of the charge on the membrane Opening of K channels Membrane Membeane current imA/cm potential (mV)1) A 100-um diameter nerve axon has the following properties: rm = 2.5 x 104 ohm x cm, ri = 1 x 105 ohm/cm, r0 = 0, cm = 3 x 10-8 F/cm. The permeability to Cl- is very high and Cl- ions are at resting potential Vm. A steady inward current is injected into the axon resulting in a Vm of -110 mV at the site of current injection. If the Vm 3 mm from the site of injection is -94.5 mV, what is the resting Vm?
- atch the description with the statement that best describes the following statements hyperpolarization repolarization depolarization A. usually corresponds to opening of voltage-gated potassium channels B. any change in the membrane potential that moves the membrane potential to a value more positive than the resting potential (eg from -70mV to +35mV) C. any change in the membrane potential that moves the membrane potential to a value more negative than the resting potential (eg from -70mV to -85mV)Please ASAP. Thank you. A hypothetical neuronal cell shows the following intracellular and extracellular concentration of sodium, potassium, calcium, and chloride ions. Extracellular concentration (mM) Intracellular concentration (mM) (Ion)out/ (Ion)inside E ion at 37 oC Sodium ion 420 60 Potassium ion 25 420 Calcium ion 16 0.4 Chloride 565 45 How does increase in the extracellular potassium concentration to 250 mM affect the Nernst potential? Why?35.Given the following table, calculate the Resting Membrane Potential (in mV, rounded to the nearest tenths), using the GHK equation. Ion [Outside] mM [Inside] mM Relative Permeability at Rest Nernst Potential (mV) K+ 4 130 1.0 -110.2 Na+ 130 5 0.04 67.4 Cl- 75 5 0.45 -97.5
- Match the description with the statement that best describes the following statements hyperpolarization repolarization depolarization A. usually corresponds to opening of voltage-gated potassium channels B. any change in the membrane potential that moves the membrane potential to a value more positive than the resting potential (eg from -70mV to +35mV) C. any change in the membrane potential that moves the membrane potential to a value more negative than the resting potential (eg from -70mV to -85mV)2. a) sensation). the doctor decides to check the resting potential of her sensory nerves. The microelectrode is inserted and the intracellular potential is measured as -65 mv. What relative ionic concentrations are responsible for maintaining this membrane potential? A 47-year-old woman complains of paresthesis (tingling, pricking or burning a) [Na+ Jout > [Na+] in ; [K+]out > [K+]in b) [Na+ Jout > [Na+] in ; [K+]out [Ca2+]in d) [Na+ Jout [K+]in e) Active sodium potassium pump000 Which statement does the graph illustrate? Probability of Nat channel opening 0.8 0.6 0.4 0.2 0 -80 -60 -40 -20 0 20 40 60 Membrane potential (mV) K+ moves into of the cell as the membrane depolarizes The opening of Na* channels is voltage dependent. Na+ moves out of the cell as the membrane depolarizes Tetrodotoxin blocks both microscopic and macroscopic currents.
- Fill in the diagram, your illustration should demonstrate for each phase of the AP: 1. The relative concentration of K and Na 2. The relative voltage across the membrane 3. Any movement across the membrane of K and NA 4. The three kinds of channels in the membrane, and their state (open or closed) 5. Finally, indicate on the graph of the AP which phases correspond to hyper- polarization and which phases correspond to de- polarization Outside Outside Inside Inside Outside Inside Outside 1 Outside Inside InsideThe traces below show the action potential waveforms in an external meidum of different concentrations of * 40 100% 50% 33% 40 1 2 time (msec) calcium chloride potassium O sodiumPlease ASAP. Thanks Ion Extracellular Concentration (mM) Intracellular Concentration (mM) Na+ 440 50 K+ 20 400 Cl- 560 52 Ca++ 10 1 What is the effect of the addition of extracellular TTX and TEA on equilibrium potential? TTX blocks K channel, and TEA blocks Na Channels. No change in the equilibrium potentail. TTX blocks Na channel and TEA blocks K Channels. The equilibrium potentials become less positive TTX blocks Na channel and TEA blocks K Channels. The equilibrium potential becomes more positive for both TTX blocks Na channel and TEA blocks K Channels. No change in the equilibrium potentail. TTX and TEA blocks Na channel. No change in the equilibrium potentail.