Q: Label the parts of the cat's ovary focused under HPO. refer to the guide questions a. b. c. d. e.
A: Answer Cats ovary parts names
Q: Radioisotopes are frequently used to label molecules in a cell. The fate of atoms and molecules in a...
A: The different biomolecules perform different functions within the cells. From the nucleus to the pla...
Q: How do human activities negatively affect biodiversity? Cho A introducing invasive species
A: The three human activities negatively affect biodiversity that apply - introducing invasive speci...
Q: What is a DNA nucleotide? A chain of DNA subunits The building block, or basic unit, of DNA A deoxyr...
A: DNA is a double helical molecule. It is found in the nucleus of the cell in the chromosome. It acts ...
Q: Which of the following neurotransmitters does NOT have one NH2 unit in its structure? O serotonin O ...
A: Neurotransmitters are specific molecules that are released from the presynaptic neuron and responsib...
Q: explain why spherocytes and sickle cells will decrease the ESR. Your answer
A: The fluid in the body that delivers oxygen and nutrients to the cells, as well as removes metabolic ...
Q: When using the comparative method (planned comparisons) to study why Violet-throated Starfrontlet (a...
A: Answer : a. A closely related species of starfrontlet that has an unusual haemoglobin protein.
Q: Consider the following estimates:(a) There are 7 x 109 humans living on this planet.(b) Each individ...
A: Answer - a) There are currently 1.4×109 mutations present in the human population. this is calculate...
Q: Which of the following levels of protein structure may be affected by hydrogen bonding? (a) primary ...
A: Protein is the biomolecule which comprise the one or more long chain of amino acids which belongs to...
Q: How might early dog domestication compare with pet dog breeding in the U.S. today? Explain in detail...
A: Early dog domestication- It's found that the earliest dogs in US were not domesticated from local wo...
Q: What is this figure showing (overall first)? What is happening at each step? How are the little circ...
A: The neurons are the cells of the nervous system that are responsible for the generation and transmis...
Q: Metabolism is built on two distinctly different types of pathways: catabolic and anabolic. Which of...
A: Sun is the only source of energy on the Earth. This energy is harnessed by plants. The light energy ...
Q: Suppose Melissa started growing four o'clock plants, Mirabilis jalapa, in her garden. She noticed th...
A:
Q: What is the problem with talking about human pheromone activity? O The words are really difficult to...
A: Pheromones are mild to strong chemicals secreted by organisms. In birds and other animals these act ...
Q: give 5 topics in relation to teenagers health
A: Sexual Health: - Teenage is the time when humans start exploring sexual aspects and hence is associa...
Q: Antisocial personality disorder is woven of both biological and psychological strands. Discuss
A: Antisocial personality disorder (ASPD) is a typical mental health condition. People with ASPD may no...
Q: me this teedback system. 4- Identify all the components of this particular feedback system and speci...
A: Answer 4: - Increased Temperature sensed by Receptors in Hypothalamus> More blood directed to ski...
Q: Why are all of the fossil taxa from the Pliocene in this module called hominins?
A: Fossils are the preserved remains of plants and animals that were buried beneath ancient oceans, lak...
Q: What effect does melatonin have on the body? O. Increased levels cause alertness Two of these answer...
A:
Q: D Question 4 Which mass extinction led to the disappearance of the dinosaurs? O Triassic O Cretaceou...
A: The recurrent rise and disintegration of ice sheets and glaciers driven by the Milankovitch cycles, ...
Q: In Neurospora, the mutant stp exhibits erratic stop-andstart growth. The mutant site is known to be ...
A: mtDNA stands for mitochondrial DNA. If an stp strain is used as the female parent in a cross with a...
Q: This photograph was taken in 2004, 24 years after Mount Saint Helens erupted. Compare and contrast t...
A: The Mount Saint Helens Volcano destroyed many plants, animals, etc. But through the process of succe...
Q: Question 1: Most (but not all) of the important functional groups on biological molecules a. contain...
A: A biomolecule, also known as a biological molecule, is any of the many compounds created by cells an...
Q: What are long terminal repeat (LTR) ?
A: Long terminal repeat are repetitive sequence of DNA found at the end of pro-viral DNA after reverse ...
Q: 2. Provide the sequences of the template and coding strands of a DNA double helix that was used to p...
A: The RNA or ribonucleic acid is produced from the DNA by the transcription process. RNA is used for t...
Q: Explain the types of retrotransposons ?
A: Type of genetic component which copy and paste themselves into different genomic location by the pro...
Q: Rhodophyta are able to live at extreme depths for photosynthetic organisms due to the within their c...
A: “Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: The term anaxonic means; With an axon None of these is correct Without an apparent axon O Non-dendri...
A: Neurons are fundamental units of brain and mervous system. They transmit information to the other ne...
Q: Where is information stored in DNA? O In the carbons of deoxyribose sugar O In the order of the nitr...
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms that is present in the ...
Q: Name 3 organs system in the human body??
A: All living bodies-plants, animals or microscopic organisms, are made up of cells. The term 'cell' is...
Q: What type of trait and genetic interactions are shown below? Environment Gene 1 Phenotype Gene 2 Gen...
A: Option c
Q: Parts of the Microscope 20. 19. 2. 18. 3. 17. 4. 16. 5. 15. 6. 14. 7. 13. 8. 12. 11. 10. 9.
A: It is a phase contrast microscope. It is a light microscope and it is used to enhance the contrast o...
Q: On a summer trip to the Galapagos you collect two finch species, Geospiza fortis and G. pauper and b...
A: Geospiza pauper is also known as medium tree finch, categorized under critically endangered.
Q: What are the specific ways in which individuals and environments interact?
A: In this nature, individual and environment are interactive with each other. Interaction is necessary...
Q: The figure here shows oxygen concentration in a suspension of isolated mitochondria. Immediately aft...
A: Cellular respiration involves breakdown of glucose and production of energy in the form of ATP. Diff...
Q: label what is being pointed at the human ovary
A: Introduction: The Graafian follicle is a fully grown follicle that ruptures during the ovulatory pha...
Q: A container with two amoebas splits and double its size once every second. The container will be com...
A: Amoeba is a single-celled organism that reproduces asexually. Asexual reproduction involves the divi...
Q: As we have learned in our discussions of natural selection, the ability to respond successfully to s...
A: Lactose is the main carbohydrate in milk and is a major energy source for most young mammals. The en...
Q: Count the significant digits in each of these measurements: number of significant digits ? measureme...
A: Rules for significant digits: All non zero digits are significant digits. The zeroes between the si...
Q: Upon examining the test results for the unknown carbohydrate from all the tests depicted in the imag...
A: A biomolecule is a molecule created by live cells or organisms. The most common biomolecules include...
Q: Define about lactose (lac) operon ?
A: The lactose operon also known as the lac operon is a set of genes that are specific for uptake and m...
Q: Give the methods of transposition ?
A: Deoxyribonucleic acid or DNA is a hereditary material that transfers from one generation to another....
Q: How do we isolate culture media (step by step process) and what is the purpose of bacterial culture ...
A: Introduction :- Microorganisms can be found in the natural environment, such as soil. They coexist w...
Q: 4. A patient With food indigestion has been screened and dlagnosed with steatorrhea (the excretion o...
A: Solution: Steatorrhea: it is a condition in which undigested fat are excreted out through faeces. C...
Q: What molecule is involved in organism to organism communication? O Hormones O Sebaceous sweat glands...
A: Pheromones are chemical messengers and chemical signals produce by animals.
Q: What happens when you eat? How does a breakfast of scrambled eggs with spinach and multi-grain toast...
A: Introduction: Nutrients are components in food that an organism uses to survive and grow. They are ...
Q: Assume that diploid plant A has a cytoplasm genetically different from that of plant B. To study nuc...
A: Pollination is the process of transporting pollen from the anther (male part of a flower) to the sti...
Q: Calculate the percentage of the total calories per serving that come from total fat. • Based on a 2...
A: To calculate this , divide a food / drinks calories from fat by total calories (this information giv...
Q: Explain comprehensively the secondary growth in dicotyledonous plant stem from the very early stage ...
A: Dicotyledonous Stem The transverse section of a typical young dicotyledonous stem shows that the epi...
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five ...
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5 deoxyr...
Step by step
Solved in 2 steps
- IDENTIFICATION. identily the folowing statements with a conect arewer. 1. Plants trat produce seeds enclosed in an ovary that eventually develops into seeds. 2ba nonvascular plont that grows ciose to the ground. 3. Plants that bear naked seeds A Hiratype of anthophytes plant with two seean leat in ther seedi. S. Plants that produce fower as their means of reproduction 6. It is the capocity to do work. 7. the most abundant gas in earth's atmosphere. 8. The second most abundant gas in earth's atmosphere. 9, tis the loss of the soils blological productivity due to poor Agricultural practices and industrialzation. 10.it pertains to the roie the organtms play in their respective habitats. MATCHING TYPE. Match the following terms in column with their conesponding defiritions in column A. Write the letter of your answer on the space provided Column A. Rectum Column A 11. largest organ in the body 12. a pear-shaped organ 13. a long coled tube that tils the abdomen 14. the exll point for fecal…Volatile Secondary Metabolites in Plant Stress Responses In 2007, researchers Casey Delphia, Mark Mescher, and Consuelo De Moraes (pictured at left) published a study on the production of different volatile chemicals by tobacco plants in response to predation by two types of insects: western flower thrips and tobacco budworms. Their results are shown in FIGURE 30.19. FIGURE 30.19 Volatile (airborne) compounds produced by tobacco plants in response to predation by different insects. Plants were untreated (C), attacked thrips (T), mechanically wounded (W), mechanically wounded and attacked by thrips (WT), attacked by budworms (HIV), or attacked by budworms and thrips (HVT). Values are in nanograms/day. Which treatment elicited the greatest production of volatiles?Testing Biological Control Ant-decapitating phorid flies are just one of the biological control agents used to battle imported fire ants. Researchers have also enlisted the help of Thelohania solenopsae, another natural enemy of the ants. This microsporidian (Section 23.4) is a parasite that infects ants and shrinks the ovaries of the colony's egg-producing female (the queen). As a result, a colony dwindles in numbers and eventually dies out. Are these biological controls useful against imported fire ants? To find out, USDA scientists treated infested areas with either traditional pesticides or pesticides plus biological controls (both flies and the parasite). The scientists left some plots untreated as controls. FIGURE 45.28 shows the results. FIGURE 45.28 A comparison of two methods of controlling red imported fire ants. The graph shows numbers of imported fire ants over a 28-month period Orange triangles represent untreated control plots. Green circles are plots treated with pesticides alone Black squares are plots treated with pesticide and biological control agents (phorid flies along with a microsporidian parasite). 3. If this study had ended after the first year, would you conclude that biological controls had a major effect?
- Testing Biological Control Biological control agents are used to battle red imported fire ants. Researchers have enlisted the help of Thelohania solenopsae, a natural enemy of the ants. This microsporidian (Section 23.4) is a parasite that infects ants and shrinks the ovaries of the colony's egg-producing female (the queen). As a result, a colony dwindles in numbers. Are these biological controls useful against imported fire ants? To find out, USDA scientists treated infested areas with either traditional pesticides or pesticides plus biological controls (both flies and the parasite). The scientists left some plots untreated as controls. FIGURE 45.16 shows the results. FIGURE 45.16 A comparison of two methods of controlling red imported fire ants. The graph shows the numbers of red imported fire ants over a 28-month period. Orange triangles represent untreated control plots. Green circles are plots treated with pesticides alone. Black squares are plots treated with pesticide and biological control agents (parasitoid flies and a microsporidian parasite). How did population size in the control plots change during the first four months of the study?Hawaiian Honeycreeper Phylogeny The Poouli (Melamprosops phaeosoma) was discovered in 1973 by a group or students from the University of Hawaii. Its membership in the Hawaiian honeycreeper clade was (until recently) controversial, mainly because its appearance and behavior are so different from other living honeycreepers. Its particularly lacked the old tent odor characteristic of other honeycreepers. In 2011, Heather Lerner and her colleagues deciphered phylogeny of the 19 Hawaiian honeycreepers that were not yet officially declared to be extinct at the time, including the Poouli. The researchers sequenced mitochondrial and nuclear DNA samples taken from the honeycreepers, and also from 28 other birds (outgroups). Phylogenetic analysis of these data firmly establishes the Poouli as a member of the clade, and also reveals the Eurasian rosefinch as the clades closest relative (FIGURE 18.11). FIGURE 18.11 Hawaiian honeycreeper phylogeny. This cladogram was constructed using sequence comparisons of mitochondrial DNA (whole genome), and 13 nuclear DNA loci of 19 Hawaiian honeycreeper and 28 other finch species. 1. Which species on the cladogram represents an outgroup?Hawaiian Honeycreeper Phylogeny The Poouli (Melamprosops phaeosoma) was discovered in 1973 by a group or students from the University of Hawaii. Its membership in the Hawaiian honeycreeper clade was (until recently) controversial, mainly because its appearance and behavior are so different from other living honeycreepers. Its particularly lacked the old tent odor characteristic of other honeycreepers. In 2011, Heather Lerner and her colleagues deciphered phylogeny of the 19 Hawaiian honeycreepers that were not yet officially declared to be extinct at the time, including the Poouli. The researchers sequenced mitochondrial and nuclear DNA samples taken from the honeycreepers, and also from 28 other birds (outgroups). Phylogenetic analysis of these data firmly establishes the Poouli as a member of the clade, and also reveals the Eurasian rosefinch as the clades closest relative (FIGURE 18.11). FIGURE 18.11 Hawaiian honeycreeper phylogeny. This cladogram was constructed using sequence comparisons of mitochondrial DNA (whole genome), and 13 nuclear DNA loci of 19 Hawaiian honeycreeper and 28 other finch species. 4. Which species is more closely related to the Palila (Loxioides bailleui): the Iiwi (Vestiaria coccinea) or the Maui Alauahio (Paroreomyza montana)?
- Hawaiian Honeycreeper Phylogeny The Poouli (Melamprosops phaeosoma) was discovered in 1973 by a group or students from the University of Hawaii. Its membership in the Hawaiian honeycreeper clade was (until recently) controversial, mainly because its appearance and behavior are so different from other living honeycreepers. Its particularly lacked the old tent odor characteristic of other honeycreepers. In 2011, Heather Lerner and her colleagues deciphered phylogeny of the 19 Hawaiian honeycreepers that were not yet officially declared to be extinct at the time, including the Poouli. The researchers sequenced mitochondrial and nuclear DNA samples taken from the honeycreepers, and also from 28 other birds (outgroups). Phylogenetic analysis of these data firmly establishes the Poouli as a member of the clade, and also reveals the Eurasian rosefinch as the clades closest relative (FIGURE 18.11). FIGURE 18.11 Hawaiian honeycreeper phylogeny. This cladogram was constructed using sequence comparisons of mitochondrial DNA (whole genome), and 13 nuclear DNA loci of 19 Hawaiian honeycreeper and 28 other finch species. 3. What is the sister group of the Akikiki (Oreomystis bairdi)?Sun 9. Label the archegonia in Figure 3 below. Figure 3. Marchantia archegonial head l.s. Photo by Carolyn Alling 10. Is the egg cell produced by meiosis or mitosis within an archegonium? Explain ond Obtain a prepared slide containing mature sporophytes and, using the low power lens of the microscope, find a complete sporophyte. 11. Is the sporophyte haploid or diploid? Note that the sporophyte is attached to the gametophyte by a large foot. This structure grows through the base of the venter into the storage tissue of the archegonial head. 12. What is the function of the foot? 13. Is the sporophyte an "independent" or "dependent" organism? Explain The sporophyte also consists of a stalk, or seta, and a capsule, or sporangium (see text Figure 16-8, page 371). Numerous spores and elongated elaters are enclosed by the sterile jacket layer of the capsule. The elaters have spirally arranged, hygroscopic (moisture absorbing) wall thickenings that are sensitive to very slight changes in…ASE entopy 10.)A Protin mole cule, in its folded Nalie s tade corfomation randem Coil, dvith many fossible conomatias , hus One favoured whenit is denatue d d buomn rabion. a) what must h the Alan f As for e Sdlenatired 2 ta) the Change Native Condriadion of AŚ to the tre eveigy thang b t Or -?. bet or-? what juquirumnt dloa Starle Ah H this impose Dn frotrina are to be stnuctures? it bided native