Create an input text file that has the name input.txt with the following content. In Java please. 10 45 23 14 76 55 14 34 11 4 12
Q: 1. Write a java program that will add all the "Composite Numbers" found in a "Comma Separated" file.…
A: ALGORITHM:- 1. Create the file and insert data in it. 2. Read the file and calculate the sum of…
Q: Using a text editor, create a file that contains a list of at least 15 six-digit account numbers.…
A: /File: ValidateCheckDigits.java import java.io.BufferedWriter; import java.io.File; import…
Q: Java: Write a program to read first 50 characters from a file named “input.txt". Write those 50…
A: Program Approach: Create a class readwritefile. Create the main method. Create an instance of…
Q: Consider the block of code and find the output printed on the screen after the program finishes. The…
A: The given C++ program uses the file operations and its output is described as comments in the next…
Q: Create a program that calculates the average test scores. Given the student’s name and five test…
A: Problem Statement: Create a program that calculates the average test scores. The data is input from…
Q: xt file of names, (3 names per line, 5 lines in total) followed by an age for each name. Go through…
A: input.txt Smith 25 kevin 65 Hank 54Tom 98 Ben 96 Denver 63John 52 Gandia 63 Tokeyo 29Lebaon 36…
Q: Output reversed lines of a file to another file.
A: As per the question statement, We need to write JAVA code to read data from one file and write the…
Q: 1. Given the following import statements: А. import java.util.Scanner; в. import…
A: As per our guidelines we are supposed to answer only one question please repost other question as a…
Q: Using the Java compiler, try to create a file in the same directory and take the name of file from…
A: Java Code will first read the destination of file to be saved from test.txt file and save the…
Q: Write a program that prompts the user to enter a text file, reads words from the file, and displays…
A: Given: program that prompts the user to enter a text file, reads words from the file, and displays…
Q: 1. Write a program that reads a file consisting of students' test scores in the range 0-200. It…
A: Save the text file with the name of “score” and make sure that its extension should be “.txt”. Save…
Q: Please write a Java program that will read in 5 strings stored in a text file called: dataln.txt.…
A: 1. Create class readwrite a. Create method read data i. open file using…
Q: Write a program that reads a file containing two columns of floating-point numbers Prompt the user…
A: import java.io.BufferedReader; import java.io.BufferedWriter; import…
Q: Write a program that prompts the user for an input file name, reads all words from the input file,…
A:
Q: 1. Write a Java Program to Reverse the Contents of a File and Print it (Use EilelnputStream and…
A: For this program, the following steps need to be taken: Reading file using FileInputStream and…
Q: Using a text editor, create a file that contains a list of at least 15 six-digit account numbers.…
A: Actually, java is a object oriented programming language. It is a platform independent.
Q: Write a Java code that reads an input file and display the sum and the average. (submit the code and…
A: Here I have used the Scanner class object to read the file having data. Next, I have used a while…
Q: Create a test file with a paragraph containing more than 20 lowered sentences. Read the filr,…
A: Note: Since no programming language is mentioned. I am attempting this in python. if you need it…
Q: this file is named HW3.Java can someone run it through a GNU compiler and please show me the outputs…
A: The output is shown below.
Q: SO I NEED INPUTTING THIS FILE FOR THE OUTPUT TO BE THE SAME AS THE INCLUDED DOCUMENT. I POSTED THE…
A: Hey there, I am writing the required solution based on the above given question. Please do find the…
Q: Exercise 1: Write a Python program that reads from an input files temps.txt city names and…
A: def readFile(cities,tempAvg): #open file in read mode file=open('temps.txt','r') #read all…
Q: Please Write a Java Program to perform the following operations using FileOutputStream and…
A: Program: import java.io.*;import java.util.*;import java.math.*; public class ReadPNGImage {…
Q: Write a program that use the existing file, read the integers and display them in reverse order…
A: import java.util.*; class main { // Recursive function to print from N to 1static void…
Q: Write a program that reads a file consisting of students’ test scores in the range 0–200.…
A: Step 1 I am using c++ programming language for to execute this program.
Q: Modify the code to read file tooutfile2.txt, compute and display the total. Then write the total to…
A: The answer given as below:
Q: Write a Python code that allows the user to save info about employees, shown in the following Python…
A: code :--- # for storing the data into json format import json# create a dict to store the data into…
Q: In Python, which of the following opens read_it.txt for reading in data text_file varible. a.…
A: 1) In python we use built-in open() function to open the file The open() function returns a file…
Q: Create a program that reads the text file called "data.txt". Column O contains the patient number…
A: NumPy is the python built-in package that has the functions to create an array and multidimensional…
Q: Write a program that reads a file consisting of students’ test scores in the range 0–200. It should…
A: Your program is absolutely correct but there is small wrong in text document. Don't use commas in…
Q: Write a program that reads lines of characters froma text file and writes each line as a UTF string…
A: The java program is: import java.io.*; class Exercise17_04 { public static void main(String[]…
Q: Finish the exercise Write a script SB_temp_fscanf.m which read file “monthly_temp_SB.txt" by using…
A: clear clc f=fopen('monthly_temp_SB.txt','r'); header=fscanf(f,' %s ',5); data=zeros(12,5); for…
Q: Create a program that accepts 10 positive or negative integers then in a text file prints the…
A: Here I have taken input from the user and then stored it into a list. Next, I have sorted the list…
Q: A. import java.util.Scanner; B. import java.util.InputMismatchException; E. import java.io.File; p.…
A: As per guideline, we are supposed to answer only question. Kindly repost another question as a…
Q: Write a python program that read a text file 'count.txt', and should count and display the…
A: Please find the answer below
Q: Python program to read a filename lines.py and displays the contents of the file with line number
A: Program: # Python version 3# the main functiondef main(): # define the content to write in the…
Q: Write a Java application that performs the following for an user The user is provided with the…
A: UTF-16 can be written and read from a file using the newBufferedWriter() method of Files class. To…
Q: It contains data for one movie on each line. Each Movie contains the following data items:…
A: Program firstly gets the local directoty path. The source file path has been stored into a variable…
Q: Please complete with Python write a program that reads a file containing text. Read each line and…
A: ALGORITHM:- 1. Take input for the both the filenames from the user. 2. Read line by line the input…
Q: Create a MessageDecoder program that reads from a file (one character at a time), and writes all…
A: #include <stdio.h>#include <fcntl.h> int main(int argc, char const *argv[]){ // open…
Q: Write a program that reads words from a text file and displays all the words (duplicates are not…
A: Please find the code below::: SortWords.java package fileIO; import java.io.File;import…
Q: Exercise 2: Write a Java program that allows the user to specify a file name on the command line and…
A: Overview: Counting the number of characters is important because almost all the text boxes that rely…
Q: Write a program that inputs the names of fifteen cities and stores them in a file city.txt and then…
A: Task: Write a program that inputs the names of fifteen cities and stores them in a file city.txt and…
Q: program that reads 5 integer numbers from a file"integer.txt",and store sum and average in…
A: Program: # python version 3import sysdef main(): # open the file read_file =…
Q: Please write a Java program , to write data into a file (output.txt). The output.txt file is below.…
A: Introduction Please write a Java program, to write the data into the file (output.txt). The…
Create an input text file that has the name input.txt with the following content. In Java please.
10 45 23 14 76 55 14 34 11 4 12
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse pythonThe file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAAThe file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcomposition
- Write a program to calculate students’ average test scores and their grades.You may assume the following input data is read from a text file.Johnson 85 83 77 91 76Aniston 80 90 95 93 48Cooper 78 81 11 90 73Gupta 92 83 30 69 87Blair 23 45 96 38 59Clark 60 85 45 39 67Kennedy 77 31 52 74 83Bronson 93 94 89 77 97Sunny 79 85 28 93 82Smith 85 72 49 75 63Use three arrays: a one-dimensional array to store the students’ names, a (parallel) two-dimensional array to store the test scores, and a parallel one-dimensional array to store grades. Your program must contain at least the following functions: a function called GetData to read and store data into two arrays, a function called Average that is used to calculate the average test score and grade, and a function called PrintResults to output the results. The student names should be to the left with a width of 10 columns. The test scores should be to the right with a width of 8 columns. Have your program also output the class average on a line…perform the following operations on this Text File Using Java. Display the length of the Text File, as well as total Words in this Text File How many times word Pakistan has been used in this Text File. Replace all the Words Pakistan with our Motherland. Count the frequency of The, of and are in the Text File Display total Number of Spaces in this Text File Append the text “We will work Hard and Contribute in the Development and Prosperity of the Motherland” at the end of the Text FileThe code must be in Java The program will ask the user to input the file name then read several series of heart rates from a file, compute the minimum, maximum, and fitness quotient for each series, and output the input data and computed information into a document. The final output should look like in the image given input.txt 3 8 68 69 76 78 77 77 78 80 20 67 69 78 83 83 84 79 82 79 84 83 82 83 84 79 83 80 78 84 84 5 63 71 73 78 76
- Need help writing this java code, it has three objectives: to process strings to compare, search, sort, and verify location of specific pattern to output result via interface Description Write a Java program to read a text file (command line input for file name), process the text file and perform the following. Print the total number of words in the file. (When using java_test.txt, I calculate the number of words, including number, as 254.) Print the total number of different words (case sensitive, meaning “We” and “we” are two different words) in the file. (When using java_test.txt, I calculate the number of different words, including number, as 168.) Print all words in ascending order (based on the ASCII code) without duplication. Write a pattern match method to find the location(s) of a specific word. This method should return all line number(s) and location(s) of the word(s) found in the file. Print all line(s) with line number(s) where the word is found by invoking the method…In Python Take the Deck of cards we created in Problem Solving Exercise: Shuffle and Deal Cards and write the (unshuffled) deck to a csv file. It should create a csv file with a card per row with the name, value and suit in each row (example below): 2 Spades 2 3 Spades 3 4 Spades 4 5 Spades 5 6 Spades 6 7 Spades 7 8 Spades 8 9 Spades 9 10 Spades 10 J Spades 11 Q Spades 12 K Spades 13 A Spades 14 2 Hearts 2 3 Hearts 3 I'm so confused with this question. below is my code for thisPYTHON!!!!! A file concordance tracks the unique words in a file and their frequencies. Write a program that displays a concordance for a file. The program should output the unique words and their frequencies in alphabetical order. Variations are to track sequences of two words and their frequencies, or n words and their frequencies. Below is an example file along with the program input and output: example.txt I AM SAM I AM SAM SAM I AM Enter the input file name: example.txt AM 3 I 3 SAM 3 The program should handle input files of varying length (lines). Program produces correct output given input, test 1 Test Case: Test program with example.txt Input: example.txt Results: AM 3 I 3 SAM 3 Program produces correct output given input, test 2 Test Case: Test program with test file 2 Input: test.txt Results: 3/4 1 98 1 AND 2 GUARANTEED 1 INDEED 1 PERCENT 1 SUCCEED 1 WILL 2 YES 1 YOU 2
- PLEASE COMMENT CODE In a python program, create a new file and call it “ tracking”. Write to it four lines each contains information about an order like this: 1-00654-021 Dell charger Toronto-WEST 99-49-ZAD011-76540-022 ASUS battery Milton-EAST 34-56-CBH561-09239-026 HP HD Scarborough-NORTH 12-98-AZC451-12349-029 Mac FD North York-LAWRENCE 34-49-ZWL01Add the file two more lines: 1-34567-055 Lenovo SSD Milton-ON 34-09-MT04 1-90432-091 Lenovo battery Oakville-ON 78-KL98 Define a function that searches for a brand (e.g. Dell, ASUS, etc.). Test the function in your program.Java : Create a .txt file with 3 rows of various movies data of your choice in the following table format: Movie ID number of viewers rating release year Movie name 0000012211 174 8.4 2017 "Star Wars: The Last Jedi" 0000122110 369 7.9 2017 "Thor: Ragnarok" 1. Create a class Movie which instantiates variables corresponds to the table columns. Implement getters, setters, constructors and toString. 2. Implement 2 readData() methods : the first one will return an array of Movies and the second one will return a List of movies . 3. Implement two search methods to search Movies by their rating from unsorted array and by year (first) and a rating (second) from unsorted List.4. Implement two MovieComparators to compare movies by their rating from unsorted array and by year (first) and a rating (second) from unsorted List.Java : Create a .txt file with 3 rows of various movies data of your choice in the following table format: Movie ID number of viewers rating release year Movie name 0000012211 174 8.4 2017 "Star Wars: The Last Jedi" 0000122110 369 7.9 2017 "Thor: Ragnarok" Create a class Movie which instantiates variables corresponds to the table columns. Implement getters, setters, constructors and toString. Implement 2 readData() methods : the first one will return an array of Movies and the second one will return a List of movies . Test your methods.