Consider the following two peptides: I. Ile-Trp-Ala-Met and II. Glu-His-Cys-Thr Which peptide would be more soluble in water? Answer I or II.
Q: Long chains of beta glucose monomers are held together in microfibril bundles by bonds Vanderwaals…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: centration Depicted below IS add one mole of each of the molecules as shown below. The molecule to…
A: Given, here is a cell membrane which separates a compartment in two sides. The compartments are…
Q: A diet deficient in folic acid is highly unlikely since folic acid is found in almost all foods.…
A: A diet deficient in folic acid can have serious health consequences. Folic acid, also known as…
Q: How do you draw different amino acids at ph 7? can you show me an example which I can follow to draw…
A: Amino acids are the building blocks of proteins. They are organic compounds that contain a carboxyl…
Q: Two theories of membrane structure are discussed below. Unit Membrane Model Phospholipid molecules…
A: Membrane of the cell is also known as the plasma membrane or the cell membrane. The membrane is an…
Q: tate and define the four levels of protein structure, also include the bonds found at each level?
A: Introduction Proteins are the most abundant macromolecules in our body. Proteins are made up of…
Q: 1.In this model, the substrate still needs to fit into the enzyme like a key, but instead of simply…
A: Since you have posted multiple questions, we will provide the solutiononly to the first five…
Q: 21. The structure of D-arabinose is shown below. How many stereoisomers are possible for this…
A: In carbohydrates, the carbon that is attached to four different groups is called a chiral centre.…
Q: Create a concept map connecting diabetes and gluconeogenesis inhibitors
A: Gluconeogenesis is the metabolic pathway that generates glucose from non-carbohydrate precursors.…
Q: On a single graph, sketch a qualitative velocity profile (velocity vs. time) for the enzymatic…
A: Activity of an enzyme is the amount of product produced per time. Relative activity of an enzyme is…
Q: NADH boosts gluconeogenesis in the liver. So, what do you think about this assertion?
A: Gluconeogenesis is a pathway that produces glucose from pyruvate, lactate, glycerol, Gluconeogenesis…
Q: Name of Enzyme Class Number of Enzyme Reaction Catalysed Hexokinase Phosphorylates glucose…
A: Glycolysis is a pathway that converts glucose molecules into energy by breaking into pyruvate…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: Which one of the following statements concerning the nature of fats is correct? Saturated fats are…
A: Simple fat or fat or triglycerides are fatty acid esters of glycerol. They serve as fuel reserves…
Q: Explain methods used in structural analysis of proteins
A: Proteins are polymers of amino acids. Each amino acid within a protein is linked by a peptide bond.…
Q: which of these describes the symptoms of the disease(s) caused by mutations in this gene…
A: Mutation in the following gene i.e. XPA gene, causes malfunctioning of DNA repair mechanisms of our…
Q: If you want to make 7 L of 1X TGS (Tris/Glycine/SDS Running Buffer) using 8 x TGS stock, how much of…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: Thiopurine S-methyltransferase (TPMT) is an enzyme that is responsible for the metabolism of the…
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: Assume that the experiments performed in the absence of inhibitors were conducted by adding 5 μL of…
A: We are asked to find some enzyme kinetics parameter that has a unit of s-1 . And in order to find…
Q: Prepare a schematic diagram and present it. The Figure should illustrate the interactions made…
A: Binding of drug to receptor or protein can be specific and non-specific. For the genuity of the…
Q: You are making 300 mL of MS-agar medium for plant tissue culture. You need 0.4 mg/LBAP and 0.8 mg/L…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: 1.b)Which one of the following would produce the most reliable evidence? in vitro study case report…
A: There are several different types of study designs that are used to gather evidence, each with its…
Q: what is bioenergetics ?
A: The scientific field of biochemistry focuses on all the chemical and biological processes involved…
Q: (a) () The isoelectric point (pl) of the protein, i.e., the pH at which the overall electrostatic…
A: The isoelectric point (pI) is the pH of a solution at which a given protein has a net charge of…
Q: Write schematically the synthesis of phosphatidylethanolamine through the activation of amino…
A: INTRODUCTION : Phospholipids : They are a group of biochemical compounds which are made up of fatty…
Q: Passage 1 (Questions 1-4) Human immunodeficiency virus 1 (HIV-1) protease inhibitors have been…
A: Answer 2 The Bose-Einstein Principle -Bose-Einstein condensate is a group of atoms cooled to within…
Q: CHOOSE THE ANSWER FROM THE FOLLOWING CHOICES: Phosphodiester Bond Glycosidic Bond Ester…
A: Nucleic acid can be of 2 types: DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Nucleic acids…
Q: What is the x-intercept for the above reaction on a Lineweaver-Burk plot? A. -0.5 per mM B. -1.0 per…
A: The Michaelis Menten equation: vo = vmax × [S]Km + [S] where vo is the initial rate of the…
Q: Uracil and Adenine are two nitrogen bases constitutive of RNA. Both compounds show maximum…
A: The Beer Lamberts equation relates the absorbance value given by an analyte for a particular…
Q: 7. You have a 200 mg/mL stock solution of protein. To make 20mL of 5mg/mL solution, add of stock and…
A: Dilution results in a decrease in the concentration of a substance in a mixture. A stock solution is…
Q: 8. The amino acid sequence for the beginning of the globular protein myoglobin is:…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: The figure above represents changes in different types of metabolic pathways (y-axis) as energy…
A: Metabolism is the sum of all biochemical reactions in a living system that are responsible for it's…
Q: 4. What are the ABSORBABLE units of EACH of the FOUR Biological Molecules (Macromolecules) called?…
A: Macromolecules are large complex molecules which is formed from the polymerization of thousand of…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: 1. Casein is stable in a solution, at pH values close to 7. This is because at this pH casein…
Q: Hydrogen bonds in water: (one or more may apply) Group of answer choices create surface…
A: Introduction :- The questions are all about the water molecules, their bonding pattern, the bond…
Q: ~0.766+ 47425 y-0.568x46576 . . . . . X The inhibitor binds at the active site. The inhibitor binds…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: You want to digest 1 µg of plasmid DNA in a final volume of 50 µL. Your solution containing plasmid…
A: A plasmid is an extrachromosomal DNA molecule within a cell that is distinct from chromosomal DNA…
Q: In the following polypeptide, which amino acid would be participating in hydrogen bonding with…
A: Alpha helix is one of the most prominent secondary structures formed by polypeptide chains. The…
Q: The child who fainted was taken by ambulance to the hospital. Objectively: reflexes are absent,…
A: The following steps will explain how accumulation of a specific metabolite leads to appearance of…
Q: 9. Briefly describe and draw the structure of the following disaccharides in their ring structure.…
A: A. Sucrose structure: O O| || || |O-C-O-C-H H-C-O-C-O| || || |H H B. Maltose structure: O O| || ||…
Q: What is test for carbohydrates and why is it important?
A: Introduction. There are four different types of biomolecules present in our body, carbohydrate,…
Q: dentify the disaccharide in the list below. Lactose Glucose Dextrose Galactose Fructose 1.b)In…
A: Introduction There are 4 types of biomolecules present in our body, protein, carbohydrate, lipids…
Q: The rate of transformation of S, have been determined in the presence of two compounds M and N.…
A: Enzyme Inhibitors are the substances that can bind to enzyme and inhibit the enzyme activity . On…
Q: In a case where the energy source to be used it 1 malate unit, exactly how many ATP can be yielded?…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP from oxidation of…
Q: 10. Coenzyme used in electron transport. 11. It contains an apoenzyme and a metal ion cofactor. 12.…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: If the Vitamin C tablets are stored in a warm, humid bathroom cabinet, what might happen to the…
A: Vitamin C is also known as ascorbic acid. The important functions include maintaining healthy skin,…
Q: In determining the activity of an enzyme of choice, which do you prefer, monitoring the product…
A: Enzymes are biological catalysts that enhance biochemical reactions in living organisms. The…
Q: explain the following prperties of G protein: structure of G- activation cycle and signaling pathway…
A: G proteins are the Guanine nucleotide binding proteins which functions in transducing signals…
Q: The AG of a reaction is positive. Which is TRUE? The cell cannot catalyze this reaction under any…
A: In a general reaction such as: A + B ⇌ C + D At equilibrium (steady state), the concentration of…
Q: 3 4 Ag₂O NH₂OH, H₂O KMnO H₂O*
A: 3. This is an example of Tollens's reaction. Where Ag2O and NH4OH reacts to form ammonical silver…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)Draw a peptide for cys-asn- pro-gly (Using the same format in picture)For the peptide Ala-Cys-His-Ile-Leu-Asp a. Write the single letter code for the amino acid residues b. What is the charge of the peptide at pH 7.0. Assign the following pKa values: 3,4,6,8,9 c. What is the pI of the peptide
- Porcine dynorphin is a neuropeptide having 17 amino acid residues. Its structure is shown below. Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln 8. How does trypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C-terminal end. 9. List down the different fragments that would result if dynorphin were cleaved by trypsin. 10. How does chymotrypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C- terminal end. 11. List down the different fragments that would result if dynorphin were cleaved by chymotrypsin. 12. Cyanogen bromide is a chemical reagent which also cleaves peptide bonds.…you have the following peptide Arg-Ile-Pro-Leu-Asp-Lys-Glu The net charge on this peptide at pH 7.0 is ?. The net charge on this peptide at 1M HCl is ?.After the polypeptide shown below was treated with maleic anhydride, it was hydrolyzed by trypsin. (After a polypeptide is treated with maleic anhydride, trypsin will cleave the polypeptide only on the C-side of arginine.) Gly-Ala-Asp-Ala-Leu-Pro-Gly-Ile-Leu-Val-Arg-Asp-Val-Gly-Lys-Val-Glu-Val-Phe-Glu-Ala-Gly-Arg-Ala-Glu-Phe-Lys-Glu-Pro-Arg-Leu-Val-Met-Lys-Val-Glu-Gly-Arg-Pro-Val-Gly-Ala-Gly-Leu-Trp In what order will the fragments be eluted from an anion-exchange column using a buffer of pH = 5?
- Consider the following two peptides: I. N-Pro-Pro - Glu - Glu - Tyr - His - Cys - Ala - Glu - Gln - Lys - Leu - Ser - Ser - Phe-Leu- Thr - C II. N-Pro-Pro - Lys - Arg - Gly - Tyr - His - Gly - Glu - Asp - Glu - Asp - Glu - Ser - Gly-Phe- Tyr-C Give three reasons why_peptide I is more likely to form an alpha helix in aqueous solution at pH 7.0. Your reasons may include why_peptide Il is less likely to form an alpha helixSubjecting this peptide to trypsin would result in L-M-F-V-W-E-Q-A-P-S-P O A. Lys and Met-Phe-Val-Trp-Glu-Gln-Arg and Pro-Ser-Pro OB, Leu-Met-Phe-Val-Trp-Glu-Gin-Ala-Pro-Ser-Pro Leu and Met-Phe-Val-Trp-Glu-Gln-Arg-Pro-Ser-Pro OC. Op. Lys and Met-Phe-Val-Trp-Glu-Gln-Ala-Pro-Ser-Pro Leu and Met-Phe-Val-Trp-Glu-Gin-Arg-Pro-Ser-Pro OE.Show the peptides that would result from cleavage by the indicated reagent: a. Val-Arg-Gly-Met-Arg-Ala-Ser by carboxypeptidase A b. Ser-Phe-Lys-Met-Pro-Ser-Ala-Asp by cyanogen bromide c. Arg-Ser-Pro-Lys-Lys-Ser-Glu-Gly by trypsin
- Consider the peptides Ser-Glu-Gly-His-Ala and Gly-His-Ala-Glu-Ser. How do these two peptides differ?The following steps were performed using enzyme cleavage of a peptide to determine its amino acid sequence. Step 1. FDNB yield DNB-Gly Step 2. Treatment with trypsin yield 3 fragments: Tyr-Leu-Asp-Arg; Gly-Ser-Ala-Lys; Trp-Gly-Ser-Met Step 3. Treatment with pepsin gave the same 3 peptide fragments. What is the sequence of the peptide?Given the peptide Val-Ser-Gln-Lys The lateral chain of one of these amino acids can be modified by N-acetylation. Write the semi‐developed form of the lateral chain of this modified amino acid at pH 7 The lateral chain of one of these amino acids can be modified by phosphorylation. Write the semi‐developed form of the lateral chain of this modified amino acid at pH 7.