Q: If this is the original sequençe of a DNA strand: CCAGGTCCATGACTTAGC, how would you labeled the one…
A: It is an alteration in the nucleotide sequence of the genome of an organism.
Q: Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary…
A: DNA or DeoxyRiboNucleic Acid is a biomolecule which serves as a genetic material in number of…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: and these protect the strands and prevent the separated DNA strands from reannealling at Single…
A: DNA replication is the process by which a molecule of DNA is duplicated. In this, a dsDNA molecule…
Q: Complementary DNA strand of 5'-ATTCGTATTCCCGCGGTGCAAC-3' OA.) 5-TAAGCATAAGGGCGCCACGTTG-3' OB.) 3-…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…
Q: A set of overlapping DNA segments that together represent a consensus region of DNA isa) Expressed…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: DNA Sense G C A strand DNA Antisense TAC T strand AUG MRNA codon U TRNA anticodon Amino acid…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: Original DNA Sequence: T A C A C C T T G G C G A C G A C T … mRNA Sequence: Amino Acid Sequence:
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…
A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…
Q: AGTGCATTTCCAGGGA Above is a randomly generated sequence of DNA 16 bp long. Determine the Tm of this…
A: The Temperature of Melting (Tm) is defined as the temperature at which 50% of double stranded DNA is…
Q: C. Deepen (Pagpapalalim ng Kaalaman) Let us practice decoding DNA! Fill in the complimentary DNA…
A: DNA is what codes for all the cellular genetic information on earth . All cellular life forms from a…
Q: Write out the resulting DNA molecules after the following double stranded DNA molecule is digested…
A: DNA stands for deoxyribonucleic and. It is the genetic material present in the cell.
Q: How would nucleotide excision repair be affected if one of the followingproteins was missing?…
A: The process of identification and correction of damaged DNA molecule by a cell which encodes its…
Q: The 50ul of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading into the…
A: DNA yield (µg) = DNA concentration × total sample volume (ml) Usually we need : Restriction…
Q: Describe in detail the semi Conservative replication of the DNA double helix structure
A: Earlier, it was proposed that DNA replication in an organism could occur in three ways following the…
Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…
A: The central dogma of molecular biology is the metabolic process in which the double-helical…
Q: Write the complementary sequence of DNA AGCTAT AGC
A: A DNA is a double stranded structure. Both the strands are complementary to each other. Adenine (A)…
Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…
A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…
Q: o drawings just writing the answer a) Replicate this sense strand to create a double-stranded DNA…
A: The central dogma of molecular biology is the process of replication, transcription, and translation…
Q: Which of the following double stranded DNA molecules would require the most amount of energy to…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…
A: The answer is TTTAGCC. The last option.
Q: Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of DNA, making sure its…
A: According to the question, we have to give a complementary strand of DNA for the following DNA…
Q: An RNA produced from a fragment of DNA has the sequence of 5'AAUUGGCU3'. The sequence of the…
A: Genetic information in our body is stored as DNA. DNA multiples itself by replication. DNA is used…
Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…
A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…
Q: How many subunits does the E. coli DNA polymerase I have? Soloct onot
A: Option(d) 1
Q: EboV from Guinea pig Reference DNA Sample mRNA Protein
A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…
Q: DNA = TAG - TAG - GAT MRNA = Amino Acids = Phenotype = %3D
A: THE ANSWER IS IN NEXT STEP :
Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…
A: DNA probes are single-stranded DNA segments that are hybridised to indicate the existence of…
Q: Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this…
A: Cells are the most fundamental and essential unit of life in all living things. All of life's…
Q: Drag an arrow in the appropriate direction of travel for DNA Helicase Repilication fork Triphosphate…
A: During the DNA replication, the double helix structure of the DNA needs to be breakdown into a…
Q: Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA…
A: They enhance the rate of a reaction without being consumed or modified during the reaction.…
Q: Which lane shows the DNA fragment completely digested with Pst n
A: Restriction endonuclease are the enzymes which cleave the DNA at specific sites Various sites are…
Q: In a sample solution given to be analyzed; CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and…
A: DNA or deoxyribonucleotide chain is a double helical structure, containing nucleotide monomers,…
Q: Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA,…
A: DNA is the genetic material of almost all living organisms. The DNA is inherited from the parents…
Q: Hello, I have already asked for help with this question but whoever answered it copied the DNA…
A: Gene expression is the conversion of DNA into a biologically functional amino acid polypeptide…
Q: The sequence of the template strand if a nontemplate strand has the sequence 5 ATGGGGCGC3
A: The coding strand determines the correct nucleotide sequence of mRNA. The template strand acts as a…
Q: What is the melting temp. of the following double-stranded DNA fragment…
A: Melting temperature of the DNA is the temperature at which half of the DNA becomes single stranded…
Q: DNA helicase
A: DNA helicases are defined as molecular motors. It disrupts the hydrogen bonds which hold together…
Q: Complete the complementary stand of the DNA shown Complementary strand стАG GTAC TCAC G
A: It is the DNA strand in which the sequence if the constituent molecules on one strand matches the…
Q: DNA Structure Provide a detailed (hand-drawn) structure of the double-stranded DNA GGATCC
A: DNA is a nucleic acid. DNA is polymer of nucleotides. Nucleotide is composed of pentose sugar,…
Q: Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will…
A: BamHI is a type II restriction endonuclease that can recognize short DNA sequences (6 bp) and cleave…
Q: GENE F GGACGCGGG DNA MRNA Amino Acid Trait
A: GENE F DNA (Double helix- gene) (Replication) GGA CGC GGG mRNA (Transcription) GGA CGC GGG…
Q: If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…
A: Question -If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…
Q: DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA…
A: A mutation is a change in an organism's, virus's, or extrachromosomal DNA's nucleotide sequence. DNA…
Q: the complementary strand the 5'and 3' ends and identify corresponding codon as lled V, H, L, T, P,…
A: DNA is a double-stranded helical genetic material that contains hundreds of genes that code for…
Q: DNA T A G strand DNA G G strand MRNA codon U TRNA anticodon A Amino acid Alanine Glutamate
A: Genomic DNA contains information about the genes. DNA is a double-stranded molecule composed of two…
Q: Туре of mutation: Effect: protein/ amino acid Original Altered sequence sequence DNA nucleotide MRNA…
A: A mutation is a change in the nucleotide sequence of an organism's genetic material (genome).…
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.smolA eno DNA -- THE DOUBLE HELIX (modified from The Biology Corner - Worksheets and Lessons) The nucleus is a small spherical, dense body in a cell. It is called the "control center" because it controls all the activities of the cell. Chromosomes, found in the nucleus, are microscopic, threadlike strands composed of the chemical DNA (short for deoxyribonucleic acid). Chromosomes are composed of genes, which is a segment of DNA that codes for a particular protein which in turn codes for a trait. It is commonly referred to as the gene for baldness or the gene for blue eyes. In 1953, James Watson and Francis Crick established the structure of DNA. The shape of DNA is a double helix, which is like a twisted ladder. The sides of the ladder are made of alternating sugar and phosphate molecules. The sugar is deoxyribose. Color all the phosphates red (labeled with a "p"). Color all the deoxyriboses blue (labeled with a "D"). The rungs of the ladder are pairs of 4 types of nitrogen bases. The…Under physiological conditions, DNA ordinarily formsB-DNA. However, RNA hairpins and DNA-RNAhybrids adopt the structure of A-DNA. Considering thestructural differences between DNA and RNA, explain thisphenomenon.
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATTWhat is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
- DNA Structure Provide a detailed (hand-drawn) structure of the double-stranded DNA GGATCCTAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that would be formed by translating this plece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids, Use the abbrevlation of the amino adid exactly as Itswritten in the table (including the appropriate capltalizations For example it your answer for amino acid 1 is"Methionine" you would write MET in the box (not Met or met) Second Later UUU UUUC Phe UCU UAU Ser UAC UAA UAG Tyr UGU Cys U Leu UCA ucG UGC Stop uGA Beop UUG Step UGG Trp G Cuu C cuC CUA CUG CU Leu Coc CCA CG CAU Pro cGu CAC CAA CAG His CGC Arg CGA CGG 1st 3rd letter AUU A AUG AUA AUG ACU le AAU AAC AGU ACC Asn Ser U leBer ACC ACA Mct ACG The AAA AAG ACA Lys AGG Arg acu Val GCC GCA GCG GAU GAC GAA GAG GOU GGC GGA GGG Arp G GUC GUA GUG Ala Gly Glu Seovence of the protein, 1st amino acid. 2nd arnino acid: 3rd amino acid: 4th amino acid Sth amino acid: 6th amino acid: 7th amino…Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
- Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.Based on these sequences. Remove codons 24 to 66, inclusive. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGWith this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?