Code Tracing: What is the output of the code below if nums resb 3 have values (in order): 7,9,8 and strl = "this ", str2 = "isnt ", str3 = "cool" mov byte [four], 4 mov rcx, 3 mov rbx, 0 show: mov ah, 0 mov al, byte [nums+rbx] div byte [four] cmp al, 2 jne step1 cmp ah, 0 jne step2 mov rsi str3
Q: What is ISO, and why is it so important to system developers?
A: The above question is answered in step 2 :-
Q: When you mention "operating systems for resource-constrained devices," I'm not clear what you mean.…
A: Introduction: Devices that are resource restricted have limited processing and storage capabilities…
Q: Say your customer has never used the internet before. Explain in simple terms what a network server…
A: Clients, sometimes referred to as service requesters, are pieces of computer hardware or server…
Q: There must be a reason for interruptions, but what is it? What is the difference between a trap and…
A: Answer: Interrupts are signals provided by I/O devices to the CPU, instructing the CPU to halt what…
Q: It is not possible to assign several IP addresses to a single network connection in Windows. the…
A: IP addresses: An IP address, or Internet Protocol address, is a set of digits that uniquely…
Q: List 10 operating systems and discuss their five primary functions?
A: Operating systems: System software consists of the operating system. What are the five main roles…
Q: What are the drawbacks of using think clients rather than desktop computers?
A: The disadvantages of using think clients instead of desktop computers have been explained in the…
Q: False True O O Dynamic polymorphism is also known as in-run .polymorphism
A: let's see the correct answer of the question
Q: "basic input/output system" is what the abbreviation "BIOS" refers to.
A: Start: The basic input output system, sometimes known as BIOS, is a programme that is pre-installed…
Q: has Flipflop nsec and pu en the maxi
A:
Q: When it comes to computers, what's the difference between architecture and organization precisely?
A: First we have to talk about computer organization and architecture So basically it is study of…
Q: :Select the correct answer * :PDA can be represented with the help of Instantaneous description…
A: Here is the solution:
Q: computer science - What four e-commerce support technologies would you describe?
A: Introduction: Four supporting technologies are required for e-commerce:
Q: O O Adding a derived class to a base class requires substantial changes to the base class
A: Answer is in second step
Q: 15 Which of the following is the correct CSS setting for a hyperlink with a magenta (#ff00ff)…
A:
Q: What do you name a piece of software that performs a certain task, such as virus scanning, data…
A: Introduction: Computer software, sometimes known as software, is a set of instructions and…
Q: It is not possible to assign several IP addresses to a single network connection in Windows. the…
A: An IP address also known as an internet protocol address is a system-generated numeric series that…
Q: Malicious traffic being redirected from one VLAN to another, for example, might result in a network…
A: Introduction: A nation-state attacker tries to find out what their goal is in the early stages of a…
Q: her for everything she have thanked / has done O thanked / had done O None of other options O had…
A: The given questions are fill in the blank type questions.
Q: What does it imply to you, in your own words, when you hear the word "cursor"?
A: Given that: The position of a cursor on a computer display screen where text may be typed is…
Q: Please provide an example of a Turing Equivalent or Turing Complete machine/system or programming…
A: Given: What does Turing Equivalent mean? Turing equivalent refers to the capacity of a computer or…
Q: The impact that computer hacking has had on businesses that are conducted online.
A: By and large, PC hacking alludes to getting to somebody's PC, or a comparable gadget like a PDA,…
Q: An operation is considered to have been successfully stopped when the central processing unit (CPU)…
A: Overview: External-devices, primarily I/O devices, interrupt the CPU to execute an OS component.…
Q: y=1 t1=x+y*z 12=(x + y)*z 13-x^y-z-8/4*2 14-x^2-y-z/(4*2) 15=x*y^2 + z t6=(x*y)^2 + z 17=x^(1/3) +…
A: Answer: arrow _forward Statement 1-5 Operator precedence: Highest : A ^ Lower : A A*, /, % Lowest :…
Q: Guice is a popular dependency injection library in the Java programming language. However, there are…
A: Introduction: Dependency Injection handles difficulties like how an application or class can be…
Q: What exactly is DevOps? Describe in your own terms
A: DevOps: DevOps is a combined word. It is a combination of two concepts: Development Operations It…
Q: Life and Times of the Thunderbolt Kid by Bill Bryson: The only downside of my mother's working was…
A: Everyday she is cooking food, but always forgot to do it properly.
Q: Do you think it's feasible for two network interfaces to share a MAC address? Are there any…
A: Launch: A network interface is used when a computer connects to a private or public network. A…
Q: Identify The underlying causes of many catastrophic software failures in the history of computer…
A: FAILURES OF IMPORTANT SOFTWARE: Some of the most egregious software failures in computer science…
Q: uld happen if there were no relocatable programs? Memory paging might be m
A: Introduction: Memory paging is the process of collecting and accessing data and information from…
Q: Root vertex in a derivation tree must be labeled by the start symbol True False Instantaneous…
A: Here is the solution:
Q: Explain the forward function of the build list.
A: Forward list function: A list is a container for sequential data that enables neighboring memory…
Q: Same Power of two classes means both classes of Turing machines accept the same languages True O…
A: Same Power of two classes means both classes of Turing machines accept thes same languages. False.…
Q: 7:Give an example to show how to convert Numpy.array type to DataFrame? 8: Give examples to show at…
A: Example of to convert Numpy.array type to dataframe: import numpy as npimport pandas as pd array =…
Q: Explain the Boundary-Control-Entity (BCE) strategy and give an example to demonstrate it
A: Introduction: The entity-control-boundary (ECB), or, is a compositional example employed as a case…
Q: The term "computing on a GPU" is presented here.
A: Answer: computation performed by a Graphics Processing Unit, or GPUThe usage of a graphics…
Q: To begin, let's take a closer look at routing. Identify the difference between two popular routing…
A: Introduction: Routing is the capacity to transfer IP packets—data packages having an Internet…
Q: If you don't know how to live on another platform, don't replicate it... I'm looking for a…
A: Introduction: The following are the two basic techniques for assigning IDs to messages: What are the…
Q: What is the optimal RAM for an i5-4590 processor running at 3.3 GHz? Regarding the Computer
A: Introduction: SFF stands for Small Form Factor. Personal Computer (PC)
Q: Test coverage is a notion used in manual testing.
A: Introduction: By counting how many lines of code are executed for each test, we can see if our test…
Q: Two-factor authentication is a term that means something different to different people. What…
A: According to the supplied information: We must clarify two-factor authentication and how it protects…
Q: I would be interested in further information about the metrics that were used to assess the…
A: To evaluate the quality of software, you need to use two different metrics. By speaking with…
Q: suppose that you sent the following messages to your friend using an instant messenger such as…
A: Data structure refers to a way of organizing data under on variable name. These are mainly the…
Q: Assume you have access to your department's DNS servers' DNS caches.How would you go about…
A: Introduction: It's feasible to obtain access to the DNS (Domain Naming Server) server's cache. This…
Q: What Are the Elements of the Ven Neumann Architecture?
A: The question is what are the elements of the Von Neumann Architecture.
Q: Say your customer has never used the internet before. Explain in simple terms what a network server…
A: Introduction: In a client/server design, the server serves as a provider, while clients access the…
Q: Your employer called integration testing a waste of time. If each piece of software has been…
A: I disagree with the statement made. Explanation: Software testing: Generally, three layers of…
Q: When a piece of software fails, it may be quite inconvenient for the people who use it. Companies…
A: Definition: I've included points to verify before releasing the programme, as well as points that…
Q: Does the waterfall paradigm allow for consumer feedback? Compare the waterfall and spiral models to…
A: Introduction: We must determine if the waterfall approach enables for client feedback in the given…
Q: To what extent is it possible to get a wide variety of services at the network level?
A: Definition: The primary function of the data link layer is to provide services to the network layer.…
![Code Tracing: What is the output of the code below if nums resb 3 have values (in order):
7,9,8 and strl = "this ", str2 = "isnt ", str3 = "cool"
mov byte [four], 4
mov rcx, 3
mov rbx, 0
show:
mov ah, 0
mov al, byte [nums+rbx]
div byte [four]
cmp al, 2
jne step1
cmp ah, 0
jne step2
mov rsi, str3
jmp step3
step2:
step1:
step3:
;function printNow prints string referred to by rsi
mov rsi, strl
jmp step3
mov rsi, str2
push rex
call printNow
pop rcx
inc rbx
loop show](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fe9772219-ddf3-4048-9997-05a8d39b1f65%2F6ba5ef8d-bce4-408f-8780-202fba8a14b0%2Fw083fcp_processed.png&w=3840&q=75)
Step by step
Solved in 2 steps
- #python def add_func(a,b): print(f"add_func output for 1 + 2: {add_func(1, 2)}") print(f"add_func output for good + day: {add_func('good',' day')}") (add_func(1,2) = 3, (add_func('good',' day') = "good day"Soundex System Soundex is a system that encodes a word into a letter followed by three digtis that roughly describe how the word sounds. That is, similar sounding words have similar four-character codes. For instance, the words carrot and caret are both coded as C123. A slight variation of the Soundex coding algorithm is as follows: 1. Retain the first letter. 2. For the remaining letters, delete all occurrences of a, e, i, o, u, h, y, and w. 3. Replace the letters that remain with numbers so that (a) b, f, p, and v become 1 (b) c, g, j, k, q, s, x, and z become 2 (c) d and t both become 3 (d) l (that is, el) becomes 4 (e) m and n become 5 (f) r becomes 6 4. If the result contains two adjacent identical digits, eliminate the second of them. 5. Keep only the first four characters of what you have left. If you have fewer than four, then add zeros on the end to make the string have length four. Write a program that carries out the algorithm. See Fig. 6.86.Soundex System Soundex is a system that encodes a word into a letter followed by three digtis that roughly describe how the word sounds. That is, similar sounding words have similar four-character codes. For instance, the words carrot and caret are both coded as C123. A slight variation of the Soundex coding algorithm is as follows: 1. Retain the first letter. 2. For the remaining letters, delete all occurrences of a, e, i, o, u, h, y, and w. 3. Replace the letters that remain with numbers so that (a) b, f, p, and v become 1 (b) c, g, j, k, q, s, x, and z become 2 (c) d and t both become 3 (d) l (that is, el) becomes 4 (e) m and n become 5 (f) r becomes 6 4. If the result contains two adjacent identical digits, eliminate the second of them. 5. Keep only the first four characters of what you have left. If you have fewer than four, then add zeros on the end to make the string have length four. Write a program that carries out the algorithm. See Fig. 6.86. THIS IS DONE IN VISUAL BASIC
- Vehicle Displacement You are given the velocity of shuttle traveling in a straight line as a series of data points. Write a program that computes the position (displacement) of the shuttle along this line at the time of the final data point The input is given vis standard input in the following format number of data points (0 < 65,535) on its own in • It pairs of data points, each on their own line, consisting of two integers separated by a ungle comma The first number represents the time in seconds (065535), and the second represents velocity in meters per second (4 v). Time is strictly increasing and velocity is constant between data points. The vehicle position and velocity both start at 0 May shuttles can drive in either direction, and in an added bit of realm the data points are speed-limited to about 25 mph in forward and 10 mph in reverse. However, in a reduced bit of realsm, the problem does imply that shuttles can change velocity instantaneously The output should be a single…What will be the output of given code, Explain(Numerical) Using the srand() and rand() C++ library functions, fill an array of 1000 floating-point numbers with random numbers that have been scaled to the range 1 to 100. Then determine and display the number of random numbers having values between 1 and 50 and the number having values greater than 50. What do you expect the output counts to be?
- (Numerical) Write a program that tests the effectiveness of the rand() library function. Start by initializing 10 counters to 0, and then generate a large number of pseudorandom integers between 0 and 9. Each time a 0 occurs, increment the variable you have designated as the zero counter; when a 1 occurs, increment the counter variable that’s keeping count of the 1s that occur; and so on. Finally, display the number of 0s, 1s, 2s, and so on that occurred and the percentage of the time they occurred.caleulator Create four-function. 4. f using fallowing for fractions by foomu20s Addilion: alb + cld = (a'd + b'c)/(6'd). %3D Subtraction: a/b - cld = (a*d- b'c) |(b"d). Multiplication: a|b* c/d = (a*c) / (b"c) %3D %3D • The m should display above mentioned formulas first. The should take the values of user from should then display user. The the piogram desult of each process Addition, subtraction Multiplication and Division. lines separate an on Screen.2. Test Scores File: test_scores.py Write pseudocode for the main() part of a program that asks the user to enter 4 test scores between 0 and 100, then displays a JCU grade for each score and also the average test score. When you have written the pseudocode for main, implement your solution in Python code and test it with a range of meaningful data. Remember that we've done the JCU grades question before, so copy your function from that practical code file. Sample Output Score: 3 Score: 50.5 Score: 66 Score: 100 Score 3.0, which is N Score 50.5, which is P Score 66.0, which is C Score 100.0, which is HD The average score was 54.875 Enhancements When you have that working... We asked for 4 scores. Have a look at your code... did you use 4 as a numeric literal or a constant?Change 4 to 3... Did you have to change the program in more than one place?If so, then you've missed one of the things we've taught...As a strong guideline: if you need to use the same literal more than once, you…
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…The program below stores 80 bool values into a char arr[10]. CompletesetBool and getBool. In both functions, index is the index of the boolvalues, from 0 to 79. getBool returns 1 if the bool value at index is trueotherwise 0. You will probably need most bitwise operations including shifting. void setBool ( char * arr , int index , int boolValue ) {}int getBool ( char * arr , int index ) {}int main ( void ) {char arr [10];memset ( arr , 0 , 10);setBool ( arr , 78 , 1);setBool ( arr , 40 , 0);int b78 = getBool ( arr , 78); // b78 is 1int b40 = getBool ( arr , 40); // b40 is 0return 0;}Python Programming Write a program that reads a character (string of length 1) from the user, and classifies it to one of the following: lower case letter, upper case letter, digit, or non-alphanumeric character Sample output (4 different executions): Enter a character: jj is a lower case letter.Enter a character: 77 is a digit.Enter a character: ^^ is a non-alphanumeric character.Enter a character: CC is an upper case letter.
