Choose the feature of protein synthesis in column 2 that best matches the statement in column 1. A. Eukaryotic protein synthesis B. Both prokaryotic and eukaryotic protein synthesis C. Both prokaryotic and eukaryotic protein synthesis D. Prokaryotic protein synthesis E. Prokaryotic protein synthesis F. Neither prokaryotic nor eukaryotic protein synthesis select 1. AUG is the start codon select 2. The initial amino acid is N-formylated select 3. Requires the presence of elFs for translational initiation select - 4. Peptide bond formation catalyzed by an RNA molecule select - 5. Presence of Shine-Dalgarno sequence select -6. MRNA is translated 3' → 5'

Choose the feature of protein synthesis in column 2 that best matches the statement in column 1. A. Eukaryotic protein synthesis B. Both prokaryotic and eukaryotic protein synthesis C. Both prokaryotic and eukaryotic protein synthesis D. Prokaryotic protein synthesis E. Prokaryotic protein synthesis F. Neither prokaryotic nor eukaryotic protein synthesis select 1. AUG is the start codon select 2. The initial amino acid is N-formylated select 3. Requires the presence of elFs for translational initiation select - 4. Peptide bond formation catalyzed by an RNA molecule select - 5. Presence of Shine-Dalgarno sequence select -6. MRNA is translated 3' → 5'

Name: Choose the feature of protein synthesis in column 2 that best matches
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Choose the feature of protein synthesis in column 2 that best matches the statement in column 1.A. Eukaryotic protein synthesisB. Both prokaryotic and eukaryotic protein synthesisC. Both prokaryotic and eukaryotic protein synthesisD. Prokaryotic pro

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 11QP: Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA

See similar textbooks

Similar questions

Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the sequence of the DNA strand that would be replicated from this one. GTACACATCAGATT 2. White the sequence of the messenger RNA (MRNA) molecule that would be transcribed from the DNA strand. 30 GUACACAUCAGAU00 37 38 39 3. State how many codons the sequence specifies. 40 41 42 43 44 4. State how many amino acids the sequence specifies. 45
Which of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water Photophosphorylation
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
Arrange the following steps in correct sequence. Translation1. Formation of the peptide bond2. Binding of another at RNA complex3. Activation of amino acids4. Elongation of the polypeptide chains5. Termination of polypeptide chain6. Initiation of polypeptide chain
polypeptide chains Which of the following statements is/are correct? Please make sure to sel correct answer options. Letter E is near the C-terminal end of the protein Letter B represents the 5' end of the mRNA Letter D represents the ribosome that near the end of translation as cor to the other three ribosomes shown in the figure. This process is happening in an eukaryotic cell. O Letter C represents represents charged tRNA Letter A represents the 3' end of the template DNA strand. Letter A represents the 5' end of the template DNA strand. This process is happening in a prokaryotic cell.
Which of the following is present in prokaryotes but not eukaryotes?a. exonsb. polyribosomesc. spliceosomesd. simultaneous transcription and translation
Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ a.Complementary Strand: b. Direct Transcript: c. Transcript for Translation: d.Translated Amino Acid Sequence:
a.Label the diagram b.What is one differences between initiation of prokaryotic and eukaryotic translation? A A AUCG 5'TT GGGUUUACG G E B.
with the main components involved in protein synthesis. ITEM BANK: Move to Bottom anticodon tRNA codon translation drag and drop answer here D. Growing Polypeptide Chain of Amino Acids A. Peptide Bond 100 mRNA Amino acid C. Brth 6 po ribosome drag and drop answer here drag and drop answer here. B. drag and drop answer here drag and drop ariswer here.
Which of the following statements concerning translation is NOT correct? O b. O c. Polypeptide chain is extended from the C- terminus to the N-terminus. O d. The first codon of protein synthesis is AUG. Prokaryotic transcription and translation are coupled (i.e. they occur almost at the same time and at the same place). O e. Protein synthesis takes place in ribosome. During protein synthesis, the mRNA is read from 5' to 3' direction.
A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.