Calculate the standard free-energy change, deltaG°, for the reaction in which acetaldehyde is reduced by the biological electron carrier NADH in the reaction acetaldehyde + NADH + H* → ethanol + NAD*. Then calculate the actual free-energy change, deltaG, when the acetaldehyde is 1.85 M, the NADH is 1.55 M, the ethanol is 0.10 M and the NAD* is 0.10 M, at 28.22°C and pH = 7. Give the actual
Q: Which of the following contain statements that are both correct? Aspartame triggers the…
A: Aspartame is an artificial sweetener. It first binds and activate a GPCR. The G-alpha bound to GTP ,…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: Large proteins travel/migrate fast
A: Gel filtration chromatography (GF) isolates proteins purely based on their molecular size.…
Q: Among the simplest_ , those called_, are glucose (an_) and _(a _).
A: Glucose is simple sugar which is present in body having molecular formula C6H12O6.Glucose is…
Q: Choose two amino acid and explain the metabolism.
A: Introduction: Amino acids are molecules that contain an amine and carboxylic group with side-chain…
Q: raw the structure and give the name of the pentapeptide GRAND. Encircle all peptide bonds as well
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: The protease used in this procedure functions best at 50°C. Would you expect this enzyme to be…
A: Microorganisms are classified as, psychrophiles, psychrotrophs, mesophiles, thermophiles, and…
Q: Is there a possibility that our body is too much of amino acid? If there is, what are the…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group along with a…
Q: What is the biological importance of carbon, nitrogrn and phosphorus?
A: Biomolecules are organic substances, which are majorly composed of carbon. Nitrogen and phosphorous…
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown…
A: The rate of enzyme catalyzed reactions is directly proportional to the substrate concentration. But,…
Q: The enzyme is considered to be alan* COO COO H-C-OH Phosphoglyceromutase H-C-0- ČHO-P ČH,OH…
A: Enzymes are classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases…
Q: Biochemistry Question: Give one example of 5-Carben Sugar
A: Introduction: A five-carbon sugar found in the DNA is deoxyribose. It forms the central molecule in…
Q: Most of the ultraviolet absorption of proteins at 280 nm is due to their content of O Tryptophan O…
A: Proteins in solution absorb UV light at 280 and 200 nm, exhibiting absorbance maxima at these…
Q: unfold the protein
A: here they are talking about protein unfolding. The tension applied by the cantilever during protein…
Q: Substrate 1 Site A Nonpolar Polar and neutral Polar and Site D Site B Polar and neutral Acidic…
A: Enzymes are usually composed of proteins and it catalyzes biochemical reactions in our body. It is…
Q: What amino acid residues interact with methylphenidate in DAT and NET protein active sites? please…
A: DAT and NET proteins are Dopamine Transporter and NET is Nor-Epinephrine Transporter proteins, both…
Q: Tabulate the main structural features of DNA and RNA. In one sentence, point out the salient…
A: Nucleic acids are made up of nucleotides. Nucleotides are the monomer units of nucleic acid.…
Q: The first loss of carbon in the metabolism of glucose takes place as CO2, in the formation of…
A: Glucose metabolism occurs in three stages. They are 1) Glycolysis 2) TCA cycle 3) Oxidative…
Q: Why DNA melting is required in PCR? Briefly explain how PCR can be used to detect DNA mutation.
A: PCR is polymerase chain reaction used to amplify the DNA . It was first developed by Kary Mullis. It…
Q: In kappa and iota carrageenans, gels are formed through double helical formation of two…
A: Carrageenans are polysaccharides comprised of repeating disaccharide units of sulfate derivatives…
Q: 10. The degree of unsaturation of lipid can be measured as A. saponification number B. iodine number…
A: Saturated fats are the fatty acids in which the hydrocarbon chain with a carboxyl group contains…
Q: In the 1step of the 2-step reaction shown below, which substrate/co-substrate is being oxidized?…
A: The above reaction is a part of beta oxidation of fatty acid process.
Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…
A: Here, four statements are given based on osmotic pressure and we have to find out the correct…
Q: a. What is isoelectric point? (Round your answer to two decimal places, for example: 0.13 or 1.45 or…
A: The isoelectric point (pI) is the pH at which a particular molecule carries no net electrical…
Q: Choose among proteins A, B, C, and D. 1. Protein that will most strongly bind to an anion exchange…
A: Chromatographic techniques are used to separate specific molecules from a mixture of different…
Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…
A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…
Q: state the form in which the energy is present in the carbonhydrate eaten by the ox
A: Carbohydrates, abbreviated as carbs, are sugar molecules. Carbohydrates are one of three major…
Q: Draw the basic structure of a named lipid and identify its 2 main types of component.
A: A lipid is any of a diverse group of organic compounds that are insoluble in water. They include…
Q: When [I] is 10-7 M, 99% of P's activity is inhibited. What is the Kd of this Protein- Inhibitor…
A: Protein can function as enzymes, signal molecule, ligand, receptor, etc. Its function can be…
Q: H2O2 + catalase = 2 H2O2 + O2, is an example of what enzyme specificity? * A. Stereochemical B.…
A: Catalase react with h2o2 and gives water and oxygen
Q: -Inhibitor +Inhibitor [S] (mM) Vη&νβσπ:(μmol/sec). V0&νβσπ&ν βσπ (μmol/sec) 0.0001 33 17 0.0005 71…
A: Km is the michaelis menton constant which is a substrate concentration at half Vmax. This can be…
Q: Y,G,I,F,L,Y what is the biochemical propities of this residues.
A: - Tyrosine is a non-essential amino acid that the body produces from phenylalanine. - Tyrosine is an…
Q: a reasonable biosynthesis for Compound 14 starting from Propose alanine, S-phenylalanine and ATP.
A: Given compound in a figure is Aspartame. Aspartame is a non-saccharide artificial sweetener that is…
Q: (Part A) Coenzyme-dependent enzymes can catalyze the general transformations shown below. What would…
A: The process of translation takes place in the cytoplasm which converts mRNA to…
Q: Based on the Agarose Gel Electrophoresis results, tell in which concentration range of KCl the…
A: Ion-exchange chromatography separates molecules based on their charge properties. Based on charge…
Q: Which of the following contain a correct first statement and an incorrect second statement?…
A: G proteins consist of the alpha, beta and gamma receptors for activating the cell signaling…
Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by
A: Glycoproteins are molecules that comprise protein and carbohydrate chains that are involved in many…
Q: Please describe the biochemical processes involving hemoglobin and carbonic acid buffer system when…
A: Buffer solutions are extremely important in biology and is necessary for the maintenance of…
Q: Only one of the statements below is correct; which one? O Two solutions are hypotonic when they have…
A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…
Q: Can someone please draw out phosphorylated creatine?
A:
Q: Explain the importance of knowing the conformation/structure of proteins.
A: Proteins are biomolecules composed of amino acids. The amino acids are joined together through…
Q: Using a semi-permeable membrane, dialysis allows the removal of salt ions prior to chromatography.…
A: Dialysis is a separation process that uses selective and passive diffusion via a semi-permeable…
Q: V[Choose ] Collagen Coiled-coil of alpha helices Silk fibroin Keratin Triple helical arrangement of…
A: Triple helix : Has three strands which have the same axis and differ in translation along axis.
Q: Lys and Arg Glu and Lys Pro and Asp Among these amino acid combinations listed above, only the…
A: Proteins are composed of a linear chain of amino acids attached together via peptide bonds. All…
Q: 1) What is the chemical group at the end of the R groups of basic amino acids that makes them…
A: There are twenty standard amino acids that make up all of the proteins. The twenty standard amino…
Q: For each polypeptide derived in the following sequences: 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC…
A: Polypeptides are composed of amino acids linked to each other via peptide bonds. The peptide bond…
Q: Do we need to denature proteins? Why?
A: Heating, pH fluctuations, high concentrations of chemicals like urea, or reducing agents that break…
Q: Which statement(s) correctly describe(s) protein structures? A. All hydrophobic residues are buried…
A: Proteins are made up of amino acids, which are the building blocks. Around 20 different amino acids…
Q: 1. The overall charge of this protein at pH 7 is Drop-down answer choices are [positive, negative,…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: nhibitor always binds to the allosteric site of an enzyme
A: By adhering to the active site, an inhibitor can bind to an enzyme and prevent the substrate from…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Triose phosphate isomerase In a key reaction of glycolysis, dihydroxyacetone phosphate (DHAP) is isomerized into glyceraldehyde 3-phosphate (G3P) by the action of the enzyme triose phosphate isomerase: CH₂OH C=O CH₂OPO3²- DHAP CHO HC-OH CH₂OPO3²- G3P AG°¹ +7.5 kJ/mol Because AG is positive, the equilibrium lies to the left. (a) Calculate the equilibrium constant for this reaction, assuming a temperature of 37 °C. (b) In the cell, depletion of G3P makes the reaction proceed. What is the value of AG if the concentration of G3P is kept at 1/100 of the value of the concentration of DHAP? C ZOOM +Chemical labeling of chymotrypsin by the compound tosylphenylalanine chloromethyl ketone (TPCK) modifies the His 57 in the enzyme's active site. The structure of this derivative is shown below. TPCK inactivates the enzyme because the bulky addition prevents it from cleaving nearby covalent bonds. HCI + CH, C-O Chymotrypsin-His 57 TPCK Modified enzyme True O FalseDuring the process of synthesizing palmitate (C16), an acyl ACP __________. For the sake of this question, don’t treat acetyl ACP or malonyl ACP as an acyl ACP; assume the acyl ACP is a product at least 4 carbons long. Choose ALL that apply. (A) can be condensed with malonyl ACP to produce a Cn+2 b-ketoacyl ACP (B) is formed from the reduction of a trans D2-enoyl ACP(C) is a product of acetyl transacylase(D) is reduced by NADPH (E) is a substrate for b-ketoacyl synthase(F) can be condensed with acetyl ACP to produce a Cn+2 b-ketoacyl ACP
- In order to function as an oxidative phosphorylation uncoupler (page 648), 2,4-dinitrophenol must act catalytically, not stoichio- metrically. What does this mean? Identify and discuss an important implication of this conclusion.H. OH co co2 но H co, 1-isopropylmalate 2-isopropylmalate Biosynthesis of leucine involves conversion of 1-isopropyimalate to 2-isopropylmalate (see above). This proceeds in four steps under basic enzymic catalysis via an isolable compound produced in step 2. Write a detailed mechanism for this conversion. Then, draw the intermediate compound) produced in step 2. • You do not have to consider stereochemistry. • Draw uninvolved carboxyl groups in the anionic state, and enolates as carbanions. When needed, abbreviate CoenzymeA-S- as CH3S- In your drawing. aale19. The AG, the standard free-energy change, for the isomerization of dihydroxyacetone phosphate (DHAP) to glyceraldehyde 3-phosphate (GAP) is +7.55 kJ/mol. The reaction shown below is catalyzed by an enzyme called Triose Phosphate Isomerase (TPI). OH O OH DHAP OH TPI OH M+ OH GAP OH This reaction takes place in glycolysis. At equilibrium, the ratio of GAP to DHAP is 0.0475 at 25°C and pH 7.00. Equilibrium constant, Keq = 0.0475. A) Is the above reaction endergonic or exergonic (going from left to right) under the given experimental conditions? Why? B) Can the above reaction occur spontaneously under the given experimental conditions? Why or why not?
- The standard Gibbs (free) energy of reaction (A,Gº') of the following reaction is equal to zero (at 25 °C and pH 7) pyruvate + aspartate Pyruvate, aspartate and L-alanine are mixed each at a concentration of 1 mM, without oxaloacetate. Calculate the molar concentrations of each compound when the reaction reaches equilibrium. oxaloacétate + L-alanineHis388 Glu357 His388 Glu357 Ring opening Proton HO HO abstraction HO но- G6P He NH- NH His388 His388 His388 Glu357 Glu357 Glu357 HO но HO но- но OH cis-enediol F6P Ring closure intermediate OH Describe the mechanism shown above for phosphoglucose isomerase. Describe the chemistry of each step • How the enzyme appears or might facilitate the chemistry How the enzyme increases the reaction rate.Calculate the standard free energy for creatine-phosphate hydrolysis in a cell where [creatine-P]=3 mM, [creatine]=2 mM, and [Pi]= 12.1 mM. Is the reaction exergonic or endogonic?
- Equation for the esterification of glycerol and three ethanoic acidsThe equilibrium constant for the hydrolysis of the peptide alanylglycine (Gly-Ala in the reaction from Part B) by a peptidase is K = 9.0 × 10² at 310 K. Calculate AG for this reaction. Express the Gibbs free energy to three significant figures. AG = Submit ΠΑΠΙ ΑΣΦ Request Answer ? kJ/mol Keq [Gly] [Ala] [Gly-Ala]Looking at the structure of alpha linolenic acid and knowing the electron carriers produced in each round of traditional beta oxidation for saturated fatty acid chains, how many rounds of beta oxidation will have diminished production of electron carriers due to the presence of double bonds?