BIU x x, 5 Cn E B N 0/ 10000 Word Limit (d) The arrangement of the water molecules in ice causes the ice to float. Explain how ice floating on the surface of a body of water affects the water in a way that is beneficial to the organisms in it. x² X, Ω

BIU x x, 5 Cn E B N 0/ 10000 Word Limit (d) The arrangement of the water molecules in ice causes the ice to float. Explain how ice floating on the surface of a body of water affects the water in a way that is beneficial to the organisms in it. x² X, Ω

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter5: Ground Rules Of Metabolism

Section: Chapter Questions

Problem 10SQ: All antioxidants ________. a. prevent other molecules from being oxidized. b. are coenzymes c....

See similar textbooks

Related questions

Q: number of molecules in 1.0 micromole of water

A: 1.0 mole of water = 6.02 X 1023 molecules

Q: A solution is prepared by dissolving 13.5 g of glucose in 0.100 kg of water. What is the mass…

A: The mass percentage is one way of representing the concentration of an element or a compound in a…

Q: (a) Discuss THREE properties of water. B IU x? x, 5 C n EE 0/ 10000 Word Limit (b) Explain each of…

A: a. Three properties of water. Its attraction to polar molecules High-specific heat High polarity

Q: 8 7- 6- 2- 1 405 180 225 270 315 [Substrate] (nM) 45 90 135 360 450 495 540 58! What are the units…

A: Solution Michaelis menten kinetics is one of the best models of enzyme kinetics. Value of…

Q: According to the diagram, what are the two most abundant salts in sea water? Sea salts Sea water…

A: Here,it is given that sea water is a mixture of 96.5%(965g) water and 3.5%(35g) salt. The six…

Q: Based on the ternary phase diagram, a binary mixture of furfural and water will always split into…

A: * Ternary diagram is triangular coordinate system with axes at edges these are used to plot three…

Q: How many grams of calcium chloride (CaCl2; molecular weight = 111 g mole−1) would you dissolve in…

A: Molar concentration is a measure of the concentration of solute in the solution per unit volume.…

Q: How many grams (g) of solute are present in 75 mL of a 0.50 M glucose (C6H1206) solution of glucose?…

A: Biomolecules are organic molecules present in living organisms. Carbohydrates, nucleic acids,…

Q: 1. Choose the one answer that fits best. One mole is a. A baker's dozen b. One molecule of a given…

A: "Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: 3. Are there any temperature plateaus (flat regions of the curve) on the temperature versus time…

A: For Q2 you need to send the graph. So I will answer Q3. Temperature plateaus(flat regions) if…

Q: Your instructor has given you a solution with 162.0 g of glucose (C6H1206) in one liter of water.…

A: 162.0 g of glucose C6H12O6 in H2O Number of moles of solute = given mass /Molar mass . Molar mass…

Q: 140 120 Super- critical fluid A 100 CO,(s) Co,(1) 80 Critical point 30.98°C, 60 72.79 atm 40 В 20…

A: Asked : Slope of the line BC is asked for the given phase diagram.

Q: O=S=0 CI -NH OH H3C H3C Q1: How many functional groups present in the structure? Q2: Name the…

A: The answer is given below

Q: Linearize the equations: Umaz C kis + C v = UmaxC² V = k? + C²

A: Introduction The given Michaelis-Menten equation can be linearized as the Lineweaver-Burk equation,…

Q: föllowing would dispersion forces be the most important factor in determining physical properties in…

A: The London dispersion forces are defined as the weakest existing intermolecular forces. It is a…

Q: You have a 15% (m/v) solution put any units in your answer, ju

A: Dilution Equation M1 V1 = M2 V2

Q: 25.Which intermolecular force is responsible for the high surface tension of water? See figure for…

A: Water is a simple molecule made up of one oxygen atom bonded to two separate hydrogen atoms. Due to…

Q: 3. A 30.0-ml. sample of 0.20 M HA was titrated with 0.20 M NAOH. The following data were collected…

A: Given Values: Concentration of HA = 0.2 M Volume of HA = 30 ml = 0.03 L Concentration of NaOH = 0.2…

Q: Balance these chemical equations. (Use the lowest possible whole number coefficients.)

A: Using the lowest possible whole number coefficients the balanced chemical reactions are:- (d)…

Q: At pH 10, [OH-] is— 10 M 5 M 10-10 M 10-4 M 0.0000001 M

A: pH is the measure of the relative amount of free hydrogen and hydroxyl ions in the water. A pH of…

Q: statement regarding kinetic energy is true? sc.7.P.112 A The kinetic energy of an object is A O…

A: Kinetic energy equals the mass of the moving object times the square of that object's speed (v2).

Q: Calculate the Molarity of solution have 20 g of Glucose sugar C12H22O12 Dissolved in 125 g of water…

A: Weight of the sugar = 20 g The volume of solvent (Water) = 125 g or 125 ml The molecular weight or…

Q: Why does salt melt ice? O a it lowers the freezing point of water O b it heats up the ice O c it…

A: Normally water freezes at 0°C to form ice.This is the normal freezing point of ice. Upon additon of…

Q: A very weak acid has à Ka= 4.37 x M? (-) What is the [H+] of a solution of this acid that is 2.65

A: The acids are substances that can readily donate a proton. Bases are molecules that receive a…

Q: What is the Molarity of 4 moles of NaCl dissolved in 1L of water part 2 You need to make a 1…

A: Molarity is defined as no of moles of solute which was dissolved in per liter of solution.…

Q: What is the molarity of a solution if 360 g of glucose (C6H1206) is dissolved in 500 mL of solution?…

A: Molarity (M) is defined as the number of moles of solute per liter of solution. This is calculated…

Q: The inverse logarithm, or -log, of [H3O*l][OH*l] = 10*14 is pH + pOH = 14 1. What happens to the…

A: Water has many unique properties that make it very special and important for life on earth. The…

Q: In an ESI spectrum, you see a peak at m/z = 1293.51. You know that peak corresponds to a charge of…

A: The m/z is the mass to charge ratio. m/z= 1293.51 the charge is +10.

Q: 1. A small volume of water containing a high concentration of particle C is added to a container of…

A: Answer :- Option (B) is correct. - Competition by particles A and B together to occupy less space…

Q: Predict the pH of a sample of water if Kw were 10−10 or 10−20.

A: Kw is the equilibrium constant, which is denoted from the formula Kw = [H3O+] [OH-] = 10-14…

Q: A cart that weighs 15 kg is rolling down a hill with a velocity of 4.2 m/s2. What is the kinetic…

A: solution : A cart that weighs 15 kg, it means Mass= 15 kg velocity= 4.2 m/s2…

Q: Acetic acid is the principal ingredient in vinegar as shown; that's why it tastes sour. At…

A: An acid dissociation constant (Ka) is the equilibrium constant for a chemical reaction which is…

Q: What is the boiling point of 0.800 m lactose in water? (Kb for water is 0.512°C/m) °C

A: The boiling point is defined as the temperature at which the vapour pressure of a liquid is equal to…

Q: A frozen lake in winter with fish swimming below the surface is possible because of which property…

A: Lake ecosystem is a type of ecosystem in which biotic and abiotic factors interact with each other.…

Q: What is the molarity of a solution containing 12.7 g of sodium carbonate in 1.5 Lof solution? Round…

A: The molarity of a solution is the number of moles of the solute dissolved in one litre of the…

Q: f a body of water is to support life, its dissolved oxygen should be _____ ppm or mg/L.

A: Water at lower temperature should have higher mg/L of dissolved oxygen and higher %DO while warmer ,…

Q: What is the molality of the following solutions? a. 171.9 g of Sr(NO3)2 is dissolved in 1.44 kg of…

A: Introduction Molar mass of Strontium nitrate [Sr(NO3)2] =87.62+ 2×14.01+ 6×16=211.63 g/molnumber of…

Q: What is the pOH of a solution that has a pH of 5? Given: Ka x Kb = Kw, pKw = pH + pOH Group of…

A: Given Values: pH = 5.0 pOH = ?

Q: Calculate the pH of a solution if [H3O+] = 3.4 x 10-2M Indicate whether the solution is acidic,…

A: To calculate the pH of the solution The concentration of hydronium ion given as 3.2×10-2M.

Q: 780 mL of a solution that is 0.0160 M in K, starting with solid K4 Fe (CN),- Dissolve g K4 Fe (CN)6…

A: Molarity = n/Volume of solution(in L) n = number of moles 1 L = 1000 ml 1 ml = 0.001 L 780 ml = 0.78…

Q: A slice of pizza has 500 kcal. If we could burn the pizza and useall the heat to warm a 50-L…

A: Specific heat is a physical property of substance. It is the amount of heat needed per unit mass to…

Q: Which of the following wavenumber corresponds to the carbon/carbon triple bond region on an IR…

A: Carbon - Carbon triple bond is stronger than double and single bond and stronger bond absorb at…

Q: A solution of calcium phosphate in water contain 235 gms of CP per L at 30 deg c. The density of the…

A: Percentage composition is calculated as the percentage by mass of individual elements contributed to…

Q: The electrons are unequally shared in and transferred in Multiple Choice Na CI", H20 CH4. N2 02 CH4…

A: The sharing of electrons between atoms of same or different element or transfer of electrons from…

Q: is a property of water characterized as a resistance to flow and results in liquids having varying…

A: Correct answer is option d.

Q: 1) A student measures the mass of an 8 cm3 block of brown sugar to be 12.9 g. What is the density of…

A: Density is a measure of mass per volume. Density and Volume are inversely proportional to each other

Q: The pOH of a solution of NaOH is 11.30. What is the [H+] for this solution? O 2.0 x 10-3 O 2.5 x…

A: pH is the measure of the concentration of hydrogen ions in a given solution. It is measured on a log…

Q: What is the pH of a 0.25 M solution of acetic acid, Ka = 1.8 x 105. What percentage of the acid is…

A: Buffer solutions often are weak acid/strong acid and conjugate base. buffers resist the…

Q: C. Determination of SiO2 46.582 1. Mass of evaporating dish #1 and SiO2 (g) 45.330 2. Mass of…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Compare the solubility of lead carbonate in each of the following aqueous solutions: Clear All 0.10…

A: Solubility of lead carbonate in Pb(NO3)2 and K2CO3 will be less than it's solubility in pure water.…

Question

Water Properties
Submit
4
7)
8.
10
1 of 10
B IU x X, 5 C
0/10000 Word Limit
(d) The arrangement of the water molecules in ice causes the ice to float. Explain how ice floating on the surface of a body of water affects the water in a way that
beneficial to the organisms in it.
В I U
x? X2
5 ¢
Ω
0/10000 Word Limit
II
!!

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 ICE

VIEW

Step 2 ANSWER

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Which of the following substances does not participate in the CalvinBenson cycle? a. ATP b. NADPH c. RuBP d. PGAL e. O2 f. CO2
All antioxidants ________. a. prevent other molecules from being oxidized. b. are coenzymes c. balance charge d. deoxidize free radicals
We call a molecule that binds up excess hydrogen ions in a solution a(n). acid isotope base donator
A(n) ________ substance repels water. a. acidic b. basic c. hydrophobic d. polar
a. Is there a microbe that could grow on a medium that contains onlythe following compounds dissolved in water: CaCO3, MgNO3,FeCl2, ZnSO4, and glucose? Defend your answer.b. A useful mnemonic device for keeping track of major elementsrequired by most organisms is: C HOPKINS Ca Fe, Na ClMgood. Read aloud, it becomes “See Hopkin’s Cafe, NaCl (salt)M good!” What does each letter stand for?
During the recovery stage of annealing, the grain size [Select] v and dislocations [ Select) Materials with higher melting points tend to have [Select] recrystallization temperatures. As we increase the annealing temperature for a recrystallized material, the grain size generally is I Select ] fiet blmk cheices! stays the same, decreases, inccesses is not predicfable Secand blak.choices: (Carrarge toreduce energs disappear, iameese in density third blank choices: higher, aweg unpredictable farth blank choices: lacger Smeller unpredic fable
A biochemist carefully measures the molarity of salt in 56. mL of photobacterium cell growth medium to be 82. mM. Unfortunately, a careless graduate student forgets to cover the container of growth medium and a substantial amount of the solvent evaporates. The volume of the cell growth medium falls to 3.1 mL. Calculate the new molarity of salt in the photobacterium cell growth medium. Be sure your answer has the correct number of significant digits. | mM
>> emistry_101 June%202019%20(1).pdf Chemical Bonding (.. Quantum Numbers... 2.2: Atomic Orbitals... E: Chemical Equili.. Chapter 15.3: Solvin... 100% 12/14 Biomolecule category Important feature 7(a) OH SH NH2 7(b) HO OH HO HO. HO ОН ОН 7(c) 7(d) NH2 OH O=P- N° HO HO OH
Match the term to the description. Cohesion Adhesion Solvent Evaporation [Choose ] [Choose ] The conversion of water to vapor. Without this property, water would quickly evaporate from the Earth's surface. Hydrogen bonds between water and other substances. Solutes are dissolved into this substance.
5 please provide complete solution and explanation
What is the sequence of the protein that would be translated from the following mRNA molecule? Use the single letter amino acid abbreviation for your answer. 5'- UGAUGUACCUCGCCUCUACGACGGAAUCCACA - 3'
1.2. Using DEAE-cellulose as ion exchange resin, indicate the starting and ending pH for the narrowest experimental pH range used to separate an amino acid mixture consisting of Cys, His and Leu Starting pH: _____ Ending pH: _____