Below is an image of the predicted RNA secondary structure for an RNA aptamer that binds FGF5. The boxed nucleotide bases are conserved across all of the high-affinity FGF5 binding RNA aptamers. Although the precise structural mechanism of FGF5 binding is not known, provide a hypothesis for how these bases might contribute to the binding specificity. Explain your answer Loop I a G Stem I 5' 3' g-c g-c g-c₂ с u-a a-u g-c c-g u-a a 9-Ca c g-cu u-a с U Loop II UC AUGCCUC ||| ||| UAUGUG TITT ACCUACAGAGCGAC AUAC UA Stem II Stem III

Below is an image of the predicted RNA secondary structure for an RNA aptamer that binds FGF5. The boxed nucleotide bases are conserved across all of the high-affinity FGF5 binding RNA aptamers. Although the precise structural mechanism of FGF5 binding is not known, provide a hypothesis for how these bases might contribute to the binding specificity. Explain your answer Loop I a G Stem I 5' 3' g-c g-c g-c₂ с u-a a-u g-c c-g u-a a 9-Ca c g-cu u-a с U Loop II UC AUGCCUC ||| ||| UAUGUG TITT ACCUACAGAGCGAC AUAC UA Stem II Stem III

Name: Below is an image of the predicted RNA secondary structure for an RNA
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Below is an image of the predicted RNA secondary structure for an RNA aptamer that binds FGF5. Theboxed nucleotide bases are conserved across all of the high-affinity FGF5 binding RNA aptamers. Althoughthe precise structural mechanism of FGF5 bindin

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 7P

See similar textbooks

Similar questions

For the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.
If the following truncated peptide represents the active domain of the COVID19’s S-protein N-terminal ----Leu-Leu-Gly-Cys-Ile-Glu-Ser-Thr-Cys-Ala ------ C-terminal a) state the RNA sequence of this peptide given that Leu is the first amino acid b) show a point mutation using the RNA sequence & explain how it results in silent mutation effect c) show a deletion mutation using the RNA sequence & explain the consequence(s)
Consider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence- specific DNA binding proteins, it must function as a homodimer Ex. Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These hydrophobic interactions are required for dimerization. The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of: Osecondary structure O tertiary structure O quaternary structure O secondary AND quaternary structure Ⓒ tertiary AND quaternary structure
A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary structure. Itssequence was determined to be5'-AGGCGCCGACUCUACU-3'(a) Propose a two-dimensional model for this molecule.(b) What DNA sequence would give rise to this RNA moleculethrough transcription?(c) If the molecule were a tRNA fragment containing a CGA anticodon,what would the corresponding codon be?(d) If the molecule were an internal part of a message, whatamino acid sequence would result from it following translation?
EF-Tu binds all aminoacyl–tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same effi ciency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl–tRNAs (see table), explain how the tRNA–EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.
During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, II
The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S rRNA residues A1492 and A1493 as are induced by codon–anticodon pairing (Fig.). Propose an explanation for the antibiotic eff ect of paromomycin.
Briefly explain WHY a 5 7-methylguanosine cap is only added to mRNA, not to tRNA orrRNA. (Please note that I am not looking for the function of the 5’ cap, but for the mechanismrestricting capping to messenger RNA.)
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
What molecular biology strategy can best be used to determine Failure of t-RNA to bind at the A site of the small subunit of the ribosome? Explain.
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminus