Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA   1. In this given DNA, the top strand is the 5' to 3' strand and the bottom strand is the 3' to 5' strand. The bottom strand (3' to 5' strand) acts as the template for transcription. PLEASE EXPLAIN WHY. 2. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. 3. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from.

Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN:9781305251052
Author:Michael Cummings
Publisher:Michael Cummings
Chapter9: Gene Expression And Gene Regulation
Section: Chapter Questions
Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....
icon
Related questions
Question

 Below is a double-stranded DNA:

ATATGTGGTCTCGGTCCGTTAGGCAAT

TATACACCAGAGCCAGGCAATCCGTTA

 

1. In this given DNA, the top strand is the 5' to 3' strand and the bottom strand is the 3' to 5' strand. The bottom strand (3' to 5' strand) acts as the template for transcription. PLEASE EXPLAIN WHY.

2. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript.

3. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from.

 

please answer the 3 questions, thank you so much! 

Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

Blurred answer
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co…
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning