Basic features of the central dogma of molecular genetics is
Q: What is structural variation of genomes? Describe the mechanisms that create structural variants,…
A: Structural variations are referred to variation or difference in the structure of chromosome of…
Q: Explain how, at the completion of the Hershey-Chaseexperiment, the results suggested that DNA was…
A: Genetic material is the medium through which genetic information passes from a parent cell to its…
Q: To test whether you understand the processes involved in the Central Dogma of Molecular…
A: The synthesis of RNA from the DNA is known as transcription and they synthesis of protein from the…
Q: What is meant by Genetic Information NondiscriminationAct (GINA) ?
A: Genetics can be defined as the branch of biology which is concerned with the study of genes, genetic…
Q: If the MC1R protein is 317 amino acids long, why are there 954 base pairs in the coding region of…
A: The proteins are produced by the amino acids that are produced by the translation process. During…
Q: What impact does RDT has on genetics and society?
A: Using recombinant DNA technology for the production of genetically modified organisms for commercial…
Q: Which step of the Central Dogma is responsible for transmission of genetic information from…
A: The central dogma is a process through which the information present in the DNA is converted into…
Q: Describe the key features of the Watson-Crick modelfor DNA structure.
A: In the year 1953, James Watson and Francis Crick gave the double-helical structure of DNA which is…
Q: Name four mobile genetic elements.
A: Genetic materials that can move around within a genome are referred to as "mobile genetic elements."…
Q: Why Gene-prediction programs are used ?
A: In a DNA sequence, where those codons might fall even where a functional protein might be present or…
Q: how to identify mutant genes molecularly bytransformation
A: Transformation is the horizontal gene transfer by which some bacteria can take up foreign genetic…
Q: What is recombination? Mention its applications with reference to genetic engineering.
A: Answer: Introduction: Recombination means the method of generating a new blend of genes by crossing…
Q: Transposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that…
A: Step 1 Transposons or jumping gene is a DNA (deoxyribonucleic acid) sequence that can change its…
Q: What is meant by the idea that genes are “immor
A: A gene is the basic physical and functional unit of heredity.Genes are made of DNA.Some genes act as…
Q: What is Central Dogma of Molecular Biology?
A: The organisms that contain DNA as a genetic material shows a fascinating process within the cell is…
Q: In microbial genetics, what is referred to as Griffith effect?
A: Microbial genetics is a subject area within microbiology and genetic engineering. Microbial genetics…
Q: what is the concept of minimal genomes
A: A genome is the genetic material of an organism within the fields of molecular biology and genetics.…
Q: Please describe the Watson-Crick proposal.
A:
Q: Explain the central dogma of genetics at the molecular level.
A: In literal sense, dogma refers to a definite set of principles or processes. Central dogma refers to…
Q: Clearly, all humans have variations in their DNA sequences. How is it possible to sequence the human…
A: Answer- All the organism have certain amount of similarities in the DNA sequnece. In all the human…
Q: what is the meaning of Genome Restructuring
A: The arrangement of genes within the nucleus is related to chromatin topology. It is related to gene…
Q: What are the two advantages of using sequence analysis of ribosomal components in determining the…
A: Ribosome is an essential component of cellular machinery that is present across all life forms. The…
Q: What molecular biology principle is the basis for DNA fingerprinting?
A: In this question we will discuss about the molecular biology principle basis of the DNA…
Q: Approximately what percentage of the human genome isderived from transposable elements?a. 10%b.…
A: Introduction:- Transposable elements are DNA sequences that have the ability to travel or transfer…
Q: Describe the molecular aspects of the storage, expression, and transmission of genetic information.
A: Genetic information is the hereditary information that is stored in our genes in the form of…
Q: Often, the physical characteristics of genetically identical twins become increasingly different as…
A: The study of changes in the phenotype of an individual due to environmental factors without changing…
Q: What are molecular chaperones and why are they necessary?
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56…
A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…
Q: The human genome has approximately 30,000 genes, but human cells can produce over 100,000 different…
A: The human genome consists of complete set of sequences of nucleic acid which are encoded as DNA.…
Q: Explain the relationship among the following terms: genomics, proteomics, gene, protein, genotype,…
A: Introduction :- Genomics is the study of an organism's entire genome, which includes genetic…
Q: What is Central Dogma of Molecular Biology and how this concept is used in the development of…
A: Genetically modified organisms are those that have been modified by humans in order to show those…
Q: What is the Central Dogma of Molecular Genetics? What impact did the discovery of RNA tumor viruses…
A: The Central Dogma was first proposed in 1958 by Francis Crick. He was also the discoverer of the…
Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…
A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…
Q: What do you mean by “Central Dogma of Molecular genetics?”
A: The term DNA stands for deoxyribonucleic acid. Deoxyribonucleic acid is the most important…
Q: Describe the central dogma of molecular biology.With regards to DNA, what is supercoiling and what…
A: Replication is the reason for organic legacy. It duplicates a cell's DNA. The chemical Deoxyribose…
Q: Where does RNA processing fit into the central dogma of molecular genetics?
A: The central dogma is the process which governs the gene expression. A gene is expressed when an mRNA…
Q: Describe the various characteristics of the Watson–Crick doublehelix model for DNA.
A: The hereditary ingredient in the cell is genetic material. It contains all of an organism's…
Q: Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she…
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: "Whole-Genome Sequencing Is Widely Used for Sequencing and Assembling Entire Genomes". Explain this…
A: Whole genome sequencing It reveals an organism's complete DNA make-up ( allowing us to better…
Q: What is a genome and what is it composed of? What is thecentral dogma of molecular biology?
A: Genes are the hereditary units that are transmitted from one generation to another generation. The…
Q: Describe the three general groups of chemical mutagens.
A: A mutagen is a chemical or physical agent that has the capacity to change the genetic sequence in a…
Q: What key molecules are essential for Sanger sequencing?
A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…
Q: Contrast the contributions of Pauling and Ingram to our understanding of the genetic basis for…
A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…
Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…
A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…
Step by step
Solved in 3 steps
- DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?How many kilobases of the DNA strand below will code for the protein product?Which of the following statements about the DNA double helix is FALSE? O The base pairs are located in the center of the helix O The plane of the base pairs is perpendicular to the direction of the deoxyribose- phosphate backbone O The two strands have the same 5' to 3' direction (i.e, are parallel) O The base pairs stack on one another O The deoxyribose-phosphate backbone is on the outside of the helix
- The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?If one of the strands of DNA has the following sequence of bases running in the 5-S3' direction,5'-G-G-A-C-A-A-T-C-T-G-C-3' what base is closest to the 5'-end in the complementary strand?What statement about DNA polarity is TRUE? One end of the chain has a 5'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group, which is linked to another nucleotide. One end of the chain has a free 5'-OH group or 5'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group. None is linked to another nucleotide. One end of the chain has a free 3'-OH group or 3'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group, which is linked to another nucleotide. One end of the chain has only a free 5'-OH group. The other end of the chain has a free 3'-OH group. Neither is linked to another nucleotide. One end of the chain has a free 5'-OH group. The other end of the chain has a free 3'-OH group.
- The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?What is the total number of hydrogen bonds that exist between the DNA strand 5’-TTCAGAG-3’ and its complementary strand?Which of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break. B) 1; it has more A-T pairs which are connected by one hydrogen bond instead of two, so they are easier to break. C) 2; it has more C-G pairs which are connected by two hydrogen bonds instead of three, so they are easier to break. D)1; it has more A-T pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.
- What is the conformation of the glycosidic bond (i.e. orientation of the nucleobase relative to the the sugar) in the B-form of DNA? syn anti alpha heteroIf the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of the complementary strand?If one DNA strand is 5′–GATTCGTTC–3′, what is the complementary strand?