Q: Your microbiome is composed of? Question options: The transient microbiota and genetic…
A: Human microbiome is formed for all the bacteria, viruses, yeast, fungi, parasites, which are present…
Q: Disease constantly in a population are called
A: Disease constantly in a population are called Answer: 4). endemic Example: material is the endemic…
Q: In this pandemic that we are facing now, how do you see the Philippine Health Care Delivery System?
A: HEALTH CARE DELIVERY SYSTEM- The distribution of health care services to the general public is…
Q: Research on HIV vaccines is progressing, but success to date has been limited to vaccines that are…
A: HIV or the human immunodeficiency viruses is a type of Lentivirus (a subgroup of the retrovirus,…
Q: an epidemiologist is studying a new disease, or one that is beginning to emerge, would incidence or…
A: In a specific population systematic study which is driven by data and helps to determine the…
Q: Consuming food that irritates your body can lead to chronic inflammation. Group of answer choices…
A: Prolonged inflammatory response that involves a progressive change in the cells present at the site…
Q: The following graph shows the pathogenesis curve for a certain infectious disease from the time when…
A: The pathogenesis of a disease is the biological mechanism that leads to the diseased state. It…
Q: Explain why each choice (a-d) is correct or incorrect. A flu vaccine is needed seasonally to be…
A: The flu is caused by the influenza virus that contaminates the nose, throat, and lungs. The word…
Q: D5) Incidence Computation The sum of the years "at-risk" of these 12 courses is 102 students-years…
A: Rate of IncidenceOnly when there is continued follow-up of people who are at risk at the start of an…
Q: Type your response in the box. The development of antibiotics has revolutionized the treatment of…
A: Antibiotic resistance occurs when bacteria change in some way that reduces the effectiveness of…
Q: How we can Treatment Severe Combined Immunodeficiency (SCID) by using gene therapy? Please answer…
A: SEVERE COMBINED IMMUNODEFICIENCY:- SCID stands for severe combined immunodeficiency, a group of…
Q: Research on HIV vaccines is progressing, but success to date has been limited to vaccines that are…
A: HIV is highly communicable and a major health concern because it can’t be prevented by…
Q: What is communicable diseases? use your own words to explain
A: A disease is a structural or functional abnormality faced by the infected individual which has a…
Q: how to make a scenario's that patient have one of the disease that you can choose one on the…
A: There are various diseases that can occur in a person and detecting those diseases is very…
Q: Explain how we can treatment Hemophilia by using gene therapy? Please answer at your own words,…
A: Haemophilia is a inherited genetic disorder that impairs the body's ability to make blood clots.
Q: An individual is placed on antibiotic therapy. For which vitamin deficiency is he/she at greatest…
A: Note: since question 3 seems to be incomplete, si we will be solving the first one for you. Please…
Q: The fifth key recommendation on tracking infectious disease in a warming world seeks to make the…
A: The key recommendation on tracking infectious disease in a warming world are Incorporating…
Q: What is Influenza? What is the best way to prevent flu? Is there any alternative to vaccination in…
A: Influenza: it is a respiratory illness caused by influenza viruses that infect the nose, throat, and…
Q: Which statement is correct about primary prevention? Primary prevention includes health…
A: Disease is defined as an abnormal condition where the structural and functional state of the…
Q: Mention different important factors that contribute to major diseases in Bangladesh. then briefly…
A: The disease is defined as a state of illness during which an individual is unable to perform various…
Q: corresponding
A: Vaccine effectiveness studies have conclusively demonstrated the benefit of covid 19vaccines in…
Q: You are an analyst in the Florida Department of Health and you are tasked with using the SEIR model…
A: A model called SEIR is used to show how the virus spreads and how many people become infected and…
Q: Select the statement below that is NOT correct about Sickle Cell Anemia. it has a genetic…
A: It is a genetic disorder caused when there is a mutation in a gene that tells your body to make the…
Q: In the SIR model, individuals can enter but not leave the infected class. O individuals can leave…
A: * SIR ( susceptible, infectious, recovery/removed) model is classical model of disease transmission…
Q: Define the terms control,elimination and eradication as they apply to public health interventions…
A: Diseases produced by living organisms such as viruses and bacteria are known as infectious diseases.…
Q: female nurses in their forties who don't drink with
A: Vaccine: It is substance which triggers the bodies immune system against a particular disease.
Q: What is an non pharmaceutical intervention for an flu outbreak in a community? And what questions…
A: Based on limited data, the World Health Organization's recommended pandemic influenza interventions…
Q: Write a 50-word reflection paper about the importance of learning how to self-monitor oneself…
A: Communicable diseases need to be treated on a serious note by all health care personnel and should…
Q: What is contagious disease? use your own words to explain
A: contagious diseases- Such type of diseases which can readily spread from infected person to healthy…
Q: Explain why many non communicable diseases such as chd are more common in developed countries
A: Introduction A Non-communicable Disease (NCD) Is A Condition That Cannot Be Passed From One Person…
Q: Vaccinations slow or stop the spread of diseases by reducing the size of the susceptible population.…
A: Vaccines are a lot more secure. Regular insusceptibility occurs after you become ill with a…
Q: What is the major difference between common cold and flu? Why has no vaccine been developed for the…
A: Respiratory disorder causes several structural and functional alterations such as detachment of…
Q: Why is it important to get vaccinated against COVID-19? Choose the best answer. * It ensures…
A: Getting vaccinated does not ensure 100% that the person will not get infected by the virus but it…
Q: It used to be that our only method of creating vaccines was to use dead or weakened pathogens. That…
A: Yes, in earlier times the only way to create a vaccine was mimicking the infection for which the…
Q: Macrophages are found in basic IMMUNOLOGY Bone marrow Spleen Skin Blood liver
A: DISCLAIMER: Since you have asked multiple question, we will solve the first question for you. If you…
Q: Vaccines typically contain particles that are pieces of the virus or bacteria they target. How do…
A: The immune system plays a very important role in protecting the body from invasion by pathogens. It…
Q: Topic is : SARS-CoV-2 State which specific tissues and/or organs the pathogen infects in its host.…
A: A virus is a microorganism that remains inactive outside the host body. The genetic material inside…
Q: What is unique about the use of viral gene therapy in cancer immunotherapy
A: Virus have natural ability of delivering genetic material into the cells. Therefore, some of the…
Q: Which of these is an operating division of the U.S. Department of Health and Human Services? Red…
A: There are various organizations that are developed so that they can provide different sorts of…
Q: What is spontaneous generation theory and how was it refuted? Explain the theory of biogenesis and…
A: Theory regarding origin of life explained that how life came into existence . There were many…
Q: Gonorrhea is not the only human disease that is evolving resistance to antibiotics. What other…
A: Answer---
Q: Which of the following is true about neglected tropical diseases? Group of answer choices Though…
A: * Neglected Trophical disesase commonly seen in countries like Africa and Asia and Latin America…
Q: Draw an editorial cartoon on the importance of the roles of the multi-agency teams in communicable…
A: Statement cartoons are also known as political cartoons. This cartoon is drawn on the street walls.…
Q: What are the differences between contagious and communicable diseases? Explain with example.
A: A disease is an unusual condition that negatively influences the structure or function of every or…
Q: With uncommon disease why don’t companies and pharmaceuticals put time and research for uncommon…
A: It has a lot of challenges for them. One such obstacle is, there are small no. of patients…
Q: plain why gene mapping is important and how this technique can be used in disease investigation?…
A: Gene mapping is a technique that determines how much percentage genes are linked and how far they…
Q: Vaccines can be made for many types of pathogen, such as bacterial and viral pathogens. True The…
A: Pathogens are the organisms who infects the human body and causes disease.
Step by step
Solved in 2 steps with 1 images
- Part I – SymptomsCallie was 26 years old when she opened a bakery called “Callie’s Cupcakes” in downtown San Francisco with herf ancé, Jeremy. Despite the competitive market, her business was booming; everyone loved the clever recipes and thetrendy atmosphere. Between running their fast-growing business and planning for their wedding, Callie hadn’t beenable to keep to her usual eight hours of sleep a night. Although she had always lived a very healthy lifestyle, exercisingdaily and eating healthy, she just hadn’t been feeling herself lately. She was tired all the time, had dif culty breathing,felt stressed, coughed up sputum, consistently ran a low-grade fever, and had lost weight as her appetite decreased.None of these symptoms alone had been particularly alarming so she had put of seeing her physician for a few weeks.Questions1. What are Callie’s symptoms? List all that were mentioned.2. Based on the symptoms presented, what are three possible respiratory infectious diseases Callie…If a person becomes ill and the symptoms indicate infectionby a parasitic organism, treatment will depend upon correctdiagnosis of the problem. What category of anatomic studywould be most appropriate for identifying an infectious agentin the blood or muscle tissue? What kinds of effects would aninfection in the blood or muscle tissue have?Huntington’sdiseaseisanautosomaldominantconditioninhumans.Thediseaseis oftennotdiagnoseduntiladulthood,sometimesafterthepersonhashadchildren(and possiblypassedtheHuntington’salleletotheirchildren).PeoplewithHuntington’s diseaseareusuallyheterozygousandnothomozygousdominant.Assumethataperson withHuntington’sdiseasehasachildwithapersonwhodoesnothaveHuntington’s disease.WhatistheprobabilitythatthechildwillhaveHuntington’sdisease?Support youranswerwithaPunnettsquare(onnextpage).
- Cenvas quco O Mucous membranes are quite thin and fragile. How can such delicate tissue provide defense against microbial invaders? O The mucus secreted by the mucous membrane physically traps microbes. O Both the mucus and the outer layer of cells are shed frequently. O The mucus is a physical trap that contains a variety of antimicrobial chemicals. O The mucus physically traps microbes, contains a variety of antimicrobial chemicals, and is shed constantly, along with the outermost layer of cells. Question 6 A major outcome in response to the is the production of O complement cascade activation; a MAC in which a hole is built in the cell wall. O adaptive immune system; dendritic cells. O innate immune system; antibodies. O NOD activation; complement system.Period of illness Period of decline Most severe Signs and signs and symptoms symptoms Time Copyright O 2010 Pearson Education, Inc You just defined acute disease, chronic disease, and latent disease. Answer the following questions. Q1) What type of disease does the graph ( shown above) seem to represent? Q2) Once you have identified what type of disease the above graph represents, draw graphs for other two types of diseases showing different stages of growth period Q3) List microbial diseases that is an example of acute disease, chronic disease and latent disease Number of microbes Incubation period (no signs or symptoms) Prodromal period (mild signs or symptoms) Period of convalescenceforboad-spectum cverge r se neumonia Heisunstade and apast serous) C Clulte C scatnine deance e Estimatea lanomycin manterance ose and ntenal for C Rund othe nere 20mg
- partor the normal mlcroblota tnroughout one's life. Bacteria that have a parasitic relationship with their human host. Question 3 A patient suffers from conjunctivitis due to E. coll moving from the colon to the eye. What type of Infection does this describe? O An opportunistic infection that is the result of introducing normal flora into an unusual site in the body. O Aresident infection that is the result of introducing normal flora into an unusual site in the body. O An opportunistic infection that is the result of suppressing the immune system. O Atraditional infection tthat is the result of introducing normal flora into an unusual site in the body. Question 4 mobility-print-cli.msi mobility-print-cli.. IMG 6845.jpg MacBook AirThis is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acidsDescribe refsum's disease .
- K Miloura Paul - Biology_Unit 4 Pc X Seplquatic volve Sel Ciline fcal th CareX : m cceaianment A web.kamihq.com/web/viewer.html?state=%7B"kds%3A%5B 1 jGujPYSxQlex4AFCn8zftVSgM5PIG%5D%2C*action"%3A'open%2C'userld %3A"1129860039 E Miloura Paul - Darw. 100% A Kami Uploads Miloura Paul - Biology_Unit_4_Post_QuizEnzym Student Version pdf Cells in the stomach produce pepsin, an enzyme, to help digest food. Pepsin works best at a pH of 2. Which of these graphs most likely shows what will happen to the activity of pepsin as the pH of the stomach is increased? 2. EFFECT OF pH ON PEPSIN ACTIVITY A. EFFECT OF pH B. ON PEPSIN ACTIVITY pH pH EFFECT OF pH EFFECT OF pH ON PEPSIN ACTIVITY C. ON PEPSIN ACTIVITY pH pH DELL 23 2$ & 4 7 Pepsin Activity Pepsin Activity 5 Pepsin Activity Pepsin Activity COA research scientist is developing a new antimicrobial drug for a pharmaceutical company. Discuss at least 4 attibutes that this drug should posses in order to be an ideal antimicrobial drug.What is the clinicaldeficiency presented byhemophilic people? What isthe genetic cause of thatdeficiency?