Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and that the chain has openedup at a replication fork. Synthesis of an RNA primer occurs on thistemplate starting at the base that is underlined.(a) If the RNA primer consists of eight nucleotides, what is itsbase sequence?(b) In the intact RNA primer, which nucleotide has a free 3'-OHterminus?3'.......GGCTACCTGGATTCA....5'

Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and that the chain has openedup at a replication fork. Synthesis of an RNA primer occurs on thistemplate starting at the base that is underlined.(a) If the RNA primer consists of eight nucleotides, what is itsbase sequence?(b) In the intact RNA primer, which nucleotide has a free 3'-OHterminus?3'.......GGCTACCTGGATTCA....5'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Similar questions

DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?
In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?
The base analog 5-bromouracil (5BU), which sterically resembles thymine, more readily undergoes tautomerization from its keto form to its enol form than does thymine. 5BU can be incorporated into newly synthesized DNA when it pairs with adenine on the template strand. However, the enol form of 5BU pairs with guanine rather than adenine. (a) Draw the 5BU · G base pair. (b) What type of mutation results?
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG
If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG
Assume that a poly(A) tract five base pairs long produces a 20° bend in aDNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA)5 tracts are located (a) 10 base pairs apart; (b) 15 base pairs apart. Assume 10 base pairs per turn in the DNA double helix
What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and minor grooves of double-stranded DNA, and what part(s) is/are found in the DNA backbone? If a DNA-binding protein does not recognize a specific nucleotide sequence, do you expect that it binds tothe major groove, the minor groove, or the DNA backbone? Explain.
A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.
A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?
Depurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below. ...TACT... ...ATGA... Question 7 Select one or more: a) ...TAGT... ...ATCA... b) ...TACT... ...ATGA... c)...TAAT... ...ATTA... d) ...TAAT... ...AT_A... . e) ...TA_T... ...ATAA... f)...TATT... ...ATAA...
The following diagrams represent DNA molecules that are undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.