Assembly language (GNU gas at&t syntax) Write a program that subtracts var2 from var1, then put result in var3. Declare all three variables in the data segment as words. Inititalize var1 as 3231H and var2 as 2217H
Q: Write a C program to create memory for text string at run time using malloc() function, text string…
A: Code : #include <stdio.h>#include <stdlib.h> int main() { char *str = (char…
Q: 3. Write a C program containing a recursive function that will get the whole number quotient result…
A: Given: To write a C program to find quotient of two numbers.
Q: select the correct answer that describes the C++ statement Q/ int *ptr = &x; cout << * ptr; Ans/ 1/…
A: In C++, a pointer refers to a variable that holds the address of another variable. The dereference…
Q: Using the above C++ statements I am trying to create a C++ program that contains five more…
A: x is a variable intPtr is a pointer variable which stores address of a variable For address of…
Q: Write a C++ program that inputs an integer n and two square matrices with order of n. The program…
A: A matrix is an arrangement of elements in the form of rows and columns. In the C++ programming…
Q: C Operations For the parts below, record the output generated from each program (assuming the…
A: Given one is a simple c program which reads two numbers m and n from user and operations arithmetic…
Q: CODE FOR SINGLE-DIGIT CALCULATOR USING EMU8086 Write a program that would accept 2 single-digit…
A: So here we are providing you a simple calculator using assembly language and compiling in SPIM
Q: Write a program that reverses the order of the bits in an unsigned integer value. The program should…
A: Hey, since there are multiple questions posted, we will answer first question. If you want any…
Q: An operator is typing in a C language program at the keyboard of a certain microcomputer. The…
A: Below is the answer with explanation:
Q: 1. Write a c++program a user-defined function to copies one string to another with pointers. Write…
A: String: String is a collection of characters or one dimensional character array. Pointer: Pointer is…
Q: Using goto statement, write a C++ program that will ask the user for an integer and number of rows.…
A: Inside the block ask for input and if input is again y then we call the loop
Q: Find the Nth term of the series. Need C, C++, Java, Python, or Perl code for the below question.
A: Asking a program to find the nth term of the series
Q: assembly 8086 Use string instructions to write an assembly 8086 program that prompts the user to…
A: DATA SEGMENT MSG DB 80 DB 0 DB 80 DUP(\'$\') DATA ENDS CODE SEGMENT…
Q: Convert the following C++ programs into Pep/9 assembly
A: Given: #include <iostream> using namespace std; void minimum (int i1, int i2) { if…
Q: Need to make C# step by step design and code "Calculator where make a calculator program that can do…
A: c# step by step design of Calculator using System; using System.Collections.Generic; using…
Q: Convert this C++ program into x86 assembly language. please include code #include using namespace…
A: Conversion following c++ code into x86Assembly code
Q: Write and test a function that removes the leading and trailing spaces from a string.
A: Removing leading and trailing spaces from a string using c
Q: Write the program to arrange (four numbers) according to minmumuse suitable library function…
A: ANSWER: Program:
Q: 1. Use C PROGRAMMING LANGUAGE ONLY 2. Use RECURSION type of program 3. Copy and paste your code(no…
A: #include <stdio.h>int quotient(int a, int b){ return a / b;} int main(){ int a, b, quo;…
Q: Write a program in JAVA language to accept 10 integers from the user and print the maximum and…
A: Write a program in JAVA language to accept 10 integers from the user and print the maximum and…
Q: Write the syntax of a for loop (index i) from 0 to n that calculates the derivatives of a function f…
A: the syntax of a for loop (index i) from 0 to n that calculates the derivatives of a function f and…
Q: #include using namespace std; int times(int mpr, int mcand) { int prod = 0; while (mpr != 0) {…
A: Actually, given code is : #include <iostream> using namespace std; int times(int mpr, int…
Q: Translate the following C++ program to Pep/9 assembly language. Code should also be commented.…
A: MNEMONICS USED: ADDSP: Add to stack pointer (SP). Memory allocated for local variables at run-time.…
Q: Design and write a C program that performs the following functionality: 1. Prompt the user for a…
A: #include <stdio.h> int main(){ int n; char c; printf("Enter NumberOf Rows And…
Q: Indicate how each of the following is achieved in an NAMS assembly language program…
A: NASM assembly language: The Netwide Assembler(NASM) is an 80x86 assembler designed for portability…
Q: Answer the following questions. a. Convert the following infix expressions to postfix expressions.…
A: An infix operation is of form operand1 operator operand2 whereas a postfix operation is of form…
Q: #include using namespace std; int times(int mpr, int mcand) { int prod = 0; while (mpr != 0)…
A: Actually, program is a executable software that runs on a computer.
Q: problem. A character string that represents the number n, a number b1 that represents the base on…
A: It is defined as a powerful general-purpose programming language. It is used in web development,…
Q: Use pseudocode to design a swap module that accepts two arguments of the Real data type and swaps…
A: Pseudocode for swap(X,Y) Declare temp as Real temp = X X = Y Y = temp [END OF PSEUDOCODE]
Q: computer engineering lab Harry is learning the operation system and today he learned the difference…
A: Below is the detailed perl code for the given problem statement:
Q: Design and write a C program that performs the following functionality: . Prompt the user for a…
A: Given :
Q: Use C++ coding A palindrome is a number or a text phrase that reads the same backwards as forwards.…
A: PROGRAM CODE: #include <stdio.h> int main() { int n, a, b, c, d, e; int digit = 0;…
Q: MAKE A PYTHON CODE WITH 6 matrix multiplication properties. You may create your own matrices in…
A: Multiplication of matrices is not commutative.Matrix multiplication is not commutative, which is one…
Q: *1. Floating-Point Comparison Implement the following C++ code in assembly language. Substitute…
A: INCLUDE Irvine32.inc .datamssg1 BYTE "X is lower",0dh,0ah,0mssg2 BYTE "X is not…
Q: #include using namespace std; int times(int mpr, int mcand) { int prod = 0; while (mpr != 0)…
A: Converting c++ program into pep/9 assembly language The given c++ code is#include…
Q: Please write a code example in Assembly Language where A is returned as b. Please include return…
A: Here we write simple program in assembly language : ================================== 1.we take…
Q: Design and write a C program that performs the following functionality: 1. Prompt the user to enter…
A: We can get the input from the user, and for the entered text, we can change the color if and only if…
Q: Write a program in LC-3 machine language which inputs 3 numbers 0 – 9 from the keyboard to R1, R2,…
A: LC-3 Machine Language:.ORIG 0x0000 ; set the origin.FILL 0x0000 ; set the fill; R1 = 0LDC R1, 0 ;…
Q: Translate the following C++ program to Pep/9 assembly language. Code should also be commented.…
A: Steps to convert the C/C++ file to the Pep/9 assembly language Step 1: Open the command Prompt Step…
Q: Write a C++ program, using function, to compute the number of zeros in the array.
A: The above question is coded in C++.
Q: describe how you would create the program and why referencing which data structure you would use.…
A: Explanation: First of all, get the list of 10 floating-point numbers from the user without any…
Q: Write the value of each of the following expressions, using the following data declarations: double…
A: 1) (17.5 >12.0) &&(9/2<=4) property of &&(AND LOGICAL OPERATOR) is (true,…
Q: Course: Assembly Language Write an assembly program that lets the user to type some text,…
A: Create a string Traverse through the string Push the characters in the stack Count the number of…
Q: Indicate how each of the following is achieved in an NAMS assembly language program…
A: Answer to the above question is in step2.
Q: uestion An attacker successfully gets access to data stored in a computer. He crashed this data via…
A: #include <iostream>using namespace std;void TraverseString(string &str, int N){ //…
Q: Please solve the question by coding in Python. There are a total of 5 personnel in a company. Each…
A: The required code is
Q: Design and write a C program that performs the following functionality: 1. Prompt the user to enter…
A: Code: #include <cstring>#include <iostream>using namespace std; /* Function recursively…
Q: Design and write a C program that performs the following functionality: . Prompt the user for a…
A: the c code is an given below :
Assembly language (GNU gas at&t syntax)
Write a program that subtracts var2 from var1, then put result in var3.
Declare all three variables in the data segment as words. Inititalize var1 as 3231H and var2 as 2217H
Step by step
Solved in 2 steps with 1 images
- (Numerical) Write a program that tests the effectiveness of the rand() library function. Start by initializing 10 counters to 0, and then generate a large number of pseudorandom integers between 0 and 9. Each time a 0 occurs, increment the variable you have designated as the zero counter; when a 1 occurs, increment the counter variable that’s keeping count of the 1s that occur; and so on. Finally, display the number of 0s, 1s, 2s, and so on that occurred and the percentage of the time they occurred.(Statistical) In many statistical analysis programs, data values considerably outside the range of the majority of values are simply dropped from consideration. Using this information, write a C++ program that accepts up to 10 floating-point values from a user and determines and displays the average and standard deviation of the input values. All values more than four standard deviations away from the computed average are to be displayed and dropped from any further calculation, and a new average and standard deviation should be computed and displayed.Stack using C++ programmijng language please Write a program to input an arithmetic expression, then 1. Match nested brackets found the expression, if they are matched correctly proceed to step 2.2. Evaluate the expression. Please not that the operands of the expression may contain more than one digit. the cin of the arithmetic expression is :: ((5+(6/2*3)-2)+1)= you can use this function also ::: struct node { int data; node *next; node(int d,node *n=0) { data=d; next=n; } }; class stack { node *topp; public: stack(); void push(int el); bool pop(); int top(); bool top(int &el); //~stack(); //void operator=(stack &o); //stack(stack &o); }; stack::stack() { topp=0; } void stack::push(int el) { topp=new node(el,topp); } bool stack::pop() { if(topp==0) return false; node *t=topp; topp=topp->next; delete t; return true; } int stack::top() { if(topp!=0) return topp->data; } bool stack::top(int &el) { if(topp==0) return false; el=topp->data; return true; }
- C PROGRAM Create a c program that will convert number figures into words 1. You can use user-defined functions, string, array, and loops 2. Maximum input limit is 10000.00 Sample output (bold letters is for input) Enter amount in Peso: 143.50 You just entered P145.50 equivalent to One Hundred Forty Three and Fifty Centavos. Do you want to convert another amount? [Y|N]: Nc language for solution Write a program that will print out the result of the following equation using the functions in math header file. Result = x*+/y Where the values of x and y are entered by the user respectively. Expected Output: Enter the value of x and y: 2.0 25.0 Result = 13.00In C programming language Question (Strings) Write a function find_Substring() that finds a substring into a string. Pass array s1 and s2 to this function and prints if the substring is present or not. Expected Output 1: Enter string This is a javascript Enter substring script The substring is present Expected Output 2: Enter string This is a javascript Enter substring Jscript The substring is not present
- C Program to convert Decimal to Binary Decimal to binary in C: We can convert any decimal number (base-10 (0 to 9)) into binary number(base-2 (0 or 1)) by c program. Decimal Number Decimal number is a base 10 number because it ranges from 0 to 9, there are total 10 digits between 0 to 9. Any combination of digits is decimal number such as 23, 445, 132, 0, 2 etc. Binary Number Binary number is a base 2 number because it is either 0 or 1. Any combination of 0 and 1 is binary number such as 1001, 101, 11111, 101010 etc.c programing language A store asks you to write a C program to make cash payment easier for cashiers. Write a Cprogram that divides the amount of money entered by the cashier into 200 TL, 100 TL, 50 TL,20 TL, 10 TL, 5 TL, and 1 TL banknotes and shows the number of each banknote. Your programshould have an output as given below.In C programming language: Write a function that takes 3 int arguments and returns the largest of the 3.
- c ++ Using bitwise operators, create a function capable of printing a number in binary format. Example: Print (15); // must print 1111C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…C++ Programming Language: Enhance the code given by outputting: The largest number of the sequence a0 ,a1 ,a2 , ..., ak. The position of the largest number Test your program for the following values of x: 75, 111, 678, 732, 873, 2048, and 65535. Example: "For example, for the input sequence: 75, 226, 113, 340, 170, 85, 256, 128, 64, 32, 16, 8, 4, 2, 1, the program output should contain the following: The largest number of the sequence is 340 The position of the largest number is 4" Code Given: #include <iostream> #include <iomanip> using namespace std; int main() { long x; int count; long a_n; cout << "Enter a nonnegative integer: "; cin >> x; cout << endl; count = 0; a_n = x; cout << a_n << ", "; while (a_n !=1) { if (a_n %2==0) a_n = a_n / 2; else a_n = 3 * a_n + 1; count++; cout << a_n <<", "; } cout << endl; cout << "The integer k such that a_k = 1 is " << count << endl; return0; }