Q: [6.5] In the space below, briefly explain why the average times for the two CO₂ molecules you…
A: Regarding gases, a number of fundamental presumptions have been established (through…
Q: Differences in body form among modern humans are likely the result of: long term genetic…
A: A species goes through a series of changes during evolutionary processes and either adapts to its…
Q: a man who is not bald married a non bald female whose mother is bald. what is the chance the couple…
A: Baldness and hair loss are most common on the top and front of the head. Thinning frequently begins…
Q: Describe (at the cellular level) how detergents like ostrasan and SDS (from solution 2 in the…
A: The molecular method for isolating plasmid DNA from bacteria is called plasmid extraction. This…
Q: If the null hypothesis is correct, predict how the proportion of young cacti with nurse plants will…
A: The hypothesis is a supposition and explanation that is proposed. The hypothesis is made on the…
Q: Be able to describe the hemoglobin binding curve and why it is S shaped. Why is the shape important…
A: Haemoglobin binding curve is a curve where partial pressure of oxygen is plotted against the…
Q: Q11.3: Describe the THREE experimental approaches used to decipher the Genetic Code
A: Introduction : The genetic code is the set of rules by which living cells interpret information…
Q: Growers often wrap potted plants in plastic sleeves prior to shipping. If plants remain in these…
A: Plants are frequently moved from the garden or nursery to the customer's site. The use of plastic…
Q: # 1a. Balanus and Cthalamus have overlapping ranges #1b. Pisaster ochraceus, a sea star species…
A: Ecology is a field of science that deals with association and connection of living organisms with…
Q: A scientist tries to harvest bacterial cells by centrifugation; he used an RPM of 5000. If the…
A: Centrifugation is a process in which molecules are segregated out at high speed but as different…
Q: What are the units of absorbed dose? What are the units of Biologically Equivalent Dose?
A: Ionization occurs when radiation strikes and knocks electrons off an atom, resulting in charged…
Q: respiration and fermentation occurring in yeast cells; what are these metabolic activities and how…
A: *Respiration is a metabolic process in which living cells obtains energy in the form of ATP by…
Q: The following is a picture of Eosin Methylene Blue Agar. What does the growth on this plate…
A: INTRODUCTION Eosine methylene blue agar Used for the isolation of gram negative bacteria Toxic…
Q: which of the following correctly describes how protein kinase A can activate genes? A: nuclear…
A: By activating cAMP-dependent protein kinase-A (PK-A), which is activated when cAMP binds to the…
Q: Young Saguaro Cacti Under Another Plant Not Under Another Plant Total At your study site in the…
A: When the sample sizes are large, a chi-squared is a type of statistical hypothesis test employed in…
Q: 5. A man who is not bald married a non bald female whose mother is bald. A. What is the chance that…
A: Introduction:- Traits are the phenotypic expression of genotypic constituent of an individual.…
Q: Mature human insulin is synthesized from a single Gene but contains two polypeptide chains (A and B)…
A: In the control of human metabolism, insulin is crucial. The -cells in the Islets of Langerhans…
Q: 500 9. The restriction site sequence for the restriction enzyme Sau3AI and BamHI include four…
A: Introduction:- Restriction endonucleases are the bacterial enzymes that cuts double stranded DNA…
Q: I need a description about both branches of “external” and “internal” carotid artery and which…
A: The arteries that supply the blood to the brain, neck, and, head are called carotid arteries. These…
Q: Why is heating important in endosperm staining procedure?
A: Staining is a technique used to make certain structures in a sample more visible under a microscope.…
Q: Changes to the p53 protein structure can be caused by differences in DNA and can affect protein…
A: Mutations are alterations to the DNA sequence. Depending on the location of the mutation, it can be…
Q: 3. The narrow sense heritability of withers height in a population of quarter horses is 17%. The…
A: The narrow sense heritability of the hand's height of a horse population was given at 17%. The…
Q: The gene pool includes____________ Group of answer choices below: all of the fitness within a…
A: A gene pool is the collection of all the genes (including alleles) found in a population or species…
Q: 21:14 +4G KB/S LTED 41 96 09.00 Vo Microsoft Word - Assignment 02.docx Assignment 02 1. Groups of…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Which of the following describes the most likely mechanism of membrane transport used by seawater…
A: C. Active Transport Marine fish means the fishes living in saltwater remove the salt through their…
Q: Please consider Figures, 10.28, and Table 10.2 (attached), which contain data that were collected by…
A: Field tests revealed that age, rather than pollination, is what causes the green-to-red colour…
Q: For each of the following diagrams, name the type of transport happening. Then give the reason you…
A: The human body is made up of a large number of cells. They carry out essential functions in the…
Q: In wild sunflowers, populations occur that are either yellow flowers (wild type) or white flowers.…
A: A trait is a characteristic feature that is unique to specific individual. Each trait is represented…
Q: 14. Researchers discover that New Mexican whiptails mated with a different species of lizard several…
A: The New Mexican whiptails mated with different species of lizards. The population of New Mexican…
Q: Unripe fruits are hard and tart. Ripening is a process that sweetens and softens the fruit to make…
A: A positive feedback loop accelerates ripening when ethylene is present because it encourages the…
Q: In humans, having facial dimples is dominant to not having facial dimples. Mary has dimples, yet…
A: A dimple is an abnormality of the muscle that results in an indentation in the cheek, especially…
Q: Aspirin inhibits cyclooxygenase enzyme. This enzyme makes the prostaglandin hormone type your…
A: INTRODUCTION Thromboxane This is a hormone that plays an important role in platelet aggregation,…
Q: 820 eid 10 e bas ela od tot esqytoney od obvo 3. A woman with type AB blood type gave birth to a…
A: ABO grouping is based on two antigens: Antigen A and Antigen B. Using plasma antibodies and the…
Q: How the Earth's atmosphere acts as a greenhouse (be specific)? Why is Earth's greenhouse effect…
A: The sun's light can reach Earth's surface thanks to greenhouse gases, which then trap the heat that…
Q: Which of the following is least likely to result in the formation of a cancerous cell? A Dysfunction…
A: A normal cell is said to be cancerous if it looses its property of contact inhibition. In other…
Q: Discuss the human impacts on aquatic ecosystems
A: Numerous human activities have an adverse effect on the natural environment, including overcrowding,…
Q: Which ingredient(s) cause EMB to be selective?
A: INTRODUCTION Eosine methylene blue agar Selective and differential media Used for the isolation of…
Q: In nickel column affinity chromatography,how does the protein binds to column?How is the protein…
A: Column chromatography is a very common method of protein purification.Proteins may vary hugely in…
Q: Why do three medium types contain nutrients such as peptone, try prone or soytone?
A: Bacteria, molds and yeast that exists in nature can also be grown in laboratory. Including water,…
Q: Climate change is becoming an ever-growing threat to human health and biology. Research an incident…
A: Introduction Long term pattern of weather in a region is called climate. Air temperature and…
Q: Another ecologist reported a diversity index value of 1.511 in a different community nearby the one…
A: Species diversity is a "measure of biological variety seen in a certain ecological community,…
Q: Pls help sorry for the trouble. Explain the mechanism that enables a local anesthetic to work and…
A: Mechanism of Action-Local anesthetics work to block nerve conduction by reducing the influx of…
Q: Why would an old culture are more likely to form or have more endoscope than fresh ones?
A: Vegetative cells are the endospores that are produced by normal cells. Because the older culture has…
Q: Specific prevention. Exists or not. Briefly explain why.
A: A virus is defined as an infectious microorganism made up of a protein-coated segment of nucleic…
Q: Draw a diagram that shows the role that nutrition plays in human health.please help with this…
A: Nutrients are compounds present in food that drive biological activity and are necessary for the…
Q: 3. An unvaccinated patient was bitten by a dog potentially infected with the rabies virus. What…
A: A certified veterinarian must provide rabies vaccination to the animal between the ages of 3 and 4…
Q: What is the correlation between the Gram reaction and growth on EMB and MSA plates?
A: Introduction Gram staining is a process by which we can differentiate between gram positive and gram…
Q: # 1. Match the following with the correct type of ecology: Use checkmark Population Community…
A: Ecology is the study of the interaction of living organisms with each other and with the…
Q: will it affect much or less?
A: The Bradford assay is measured at 595nm in spectrophotometer.
Step by step
Solved in 2 steps
- . For each of the terms in the left column, choose thebest matching phrase in the rigf. satellite DNA 6. small basic proteins that bind toDNA and form the core of thenucleosomeg. chromatin 7. complex of DNA and proteinswhere spindle fibers attach to achromosomeh. cohesin 8. beadlike structure consisting ofDNA wound around histoneproteinsi. histones 9. protein complex that protectstelomeres from degradation andend-to-end fusionsj. shelterin 10. regions of a chromosome thatare distinguished by stainingdifferencesht column.a. telomere 1. protein complex that keepssister chromatids togetheruntil anaphaseb. G bands 2. origin of replication in yeastc. kinetochore 3. repetitive DNA found near thecentromere in higher eukaryotesd. nucleosome 4. specialized structure at the endof a linear chromosomee. ARS 5. complexes of DNA, protein, andRNA in the eukaryotic nucleusWhich of the following phases is characterized by preparation for DNA synthesis? G0 G1 G2 SIn intervals of interphase, G stands for ______. a. a gap b. growth c. Gey d. gene
- The ends of the linear chromosomes are maintained by helicase primase DNA pol telomeraseAll are true for DNA polymerase EXCEPT: / Almal geld vir DNA-polimerase, BEHALWE: A. generates dsDNA from SSDNA / genereer dsDNA vanaf SSDNA B. requires a primer with a free 5'- OH end, but the 3'-end may be phosphorylated / benodig 'n voorvoerder met 'n vrye 5'-OH-groep, maar die 3'-einde kan gefosforileer word. C. copies the sequence of nucleotides of one strand in a complementary fashion. / kopieer die volgorde van nukleotiede van een streng komplementêr. D. synthesizes new strands by adding successive nucleotides in the 5'→3' direction. / sintetiseer nuwe stringe deur opeenvolgende nukleotiede in die 5 '→ 3' rigting toe te voeg. E. copies the sequence of nucleotides of one strand to form a new second strand. / kopieer die volgorde van nukleotiede van eenIsein) are shówn in the following document: Codon Number Base Sequence of Normal DNA Transcribed Strand ТАС ТСС СТС AAT СТ AAT TTG Base Sequence of Abnormal DNA Transcribed strand ТАС ТСС СТС AAT CTT ATT TTG 7. Compare the 2 DNA sequences and explain the absence of functional casein in abnormal females.
- Natte को irvicle ie wnd te the following DNA Olympics eralls a od come odents, at wy h wy ed ip the ar (warm up) y and anawers e Period a Name Caitlin Myers be writtenin usion sentena DIRECTIONS: Complete each of the following "events" in their proper order. In the first event, you must transcribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN'. When your protein is completed, the final event is to match your protein with its proper trait (ex: tongue rolling). our. thin 1. ATGCATGCGCGACTGG G G TC GGAGTGG 5TACaTACacaCTQACC CCAQCETCACC 31 MRAA -7 AUG CA aca ca4 Eug pca atq yeg sletion Yeu. eiy Ser. HiS. Protein AGI TTC 2. ATGGTACAGAA A A -ACCAT AAGITIIS MRNA- 3. ATGTGTCCAGGTACGTCGTAAGAGATC rotcin is actually a very long molecule composed of many hundreds or thousa Idod on itself many times to create a…2. Here is the detailed view of the MCS of the PUC19 plasmid: Sma I KpnI SbfI PstI SacI XbaI ECORI BamHI Sall SphI HindIII agt GAATTCGAGCTCGGTACCCGGGGA TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGcgtaatcatggtcat 400 410 420 430 440 450 460 ...S N S SP VR PDEL TS R CAH LS P T IM T M lacZa translational start Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA that would be cut out. Show both strands. For reference, here are the recognition sequences: 5' G|GAT СС 3' 3' С СТАG|G 5' recognition sequence for BamH I 5' G GTAC|C 3' 3' cl CATG G 5' recognition sequence for Kpn I Figure 26: recognition sequences for BamH I and Kpn I.. CTGATTCCGAA TG5 ACTIVITY 7.3.1 Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new strands. Put an arrowhead in the appropriate end of each new strand to illustrate the direction of growth. .GACTAAGGCTTAG . CTGATICCGAATGS 5'... NEW STRANDS (Fill in the correct bases and supply arrowheads.)
- DNAse1 sensitivity Identifies genes that are in regions of less condensed chromatin Identifies actively transcribed geres Idenfifies condensed chromatin And B none of the above 0909of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆Approximately 90 60 30 10 % of chromatin is actually composed of DNA.