Q: SDS-PAGE is a technique that allows you to do which of the following? Separate proteins based on…
A: Proteins are made up of amino acids that are bounded together by peptide bonds. Different proteins…
Q: Determine the division of the skeleton to which each bone belongs. Patella Ribs Phalanges Cranium…
A: Introduction The internal framework of the human body is represented by the skeleton. At birth, it…
Q: Which of the following components found in the bone matrix make bone somewhat flexible and…
A:
Q: From the DNA sequence data for the eight species (A through H) shown below, what is the genetic…
A: The DNA is the genetic material in living organisms that shows specific sequence of nucleotides. The…
Q: What is visible illness and invisible illness ?
A: The distinction is made between the terms disease, illness, and sickness. The term disease literally…
Q: Anaphase A. Is the phase during which sister chromatids separate and move to opposite poles b.…
A: Mitosis is the division of a diploid (2n) mother cell and production of two diploid (2n) and…
Q: Draw a strict consensus tree based on your tree and Tree 1. Circle all the polytomies
A: Strict consensus tree : To determine the phylogenetic relationship the strict consensus tree is one…
Q: Explain the mechanisms of the three types of ELISA we discussed in lab: 1) direct, 2) indirect, 3)…
A: ELISA known as enzyme linked immunosorbent assay. This technique is commonly used for the detection…
Q: How is GMO negatively impacting the companies that are making GMO?
A: A genetically modified organism (GMO) is any organism whose genetic material has been altered using…
Q: What would you call these cells?
A: Introduction:. Cells are the unit of living things. They provide structure to body of any living…
Q: List the classification of fatty acids based on their chemical structures, as well as their…
A: Introduction :- The building blocks of fat in our bodies and the food we eat are called fatty acids.…
Q: Homologous chromosomes come together and line up along their entire lengths A. in meiosis in…
A: Meiosis is a unique form of germ cell division in sexually reproducing animals that results in the…
Q: 26. What is the start codon and the corresponding amino acid for which it codes? FIISI DAS G UUU UUC…
A: The protein is synthesized by the translation process. The protein synthesis takes place in the…
Q: to answer the next A diet rich in lycopene, a nutrient found in tomatoes, can reduce the risk of…
A:
Q: Here is how to start. You have to show the derived characteristic for each phylum (red) on top of…
A: Disclaimer: - According to Bartleby guidelines, only the 1st question can be answered unless…
Q: What would happen if a chromosome didn't have telomeres, or telomerase was faulty?
A: In DNA replication, the DNA unwinds, and the two strands detach at the "replication origins" a…
Q: Which statement is usually true about phylogenetic trees? a) nodes represent points when traits…
A: Cladogenesis represents divergent evolution or phylogenetic evolution in which parental population…
Q: The normal chromosome number of a spermatogonium in a male lynx is The Canada lynx has a diploid…
A: Chromosome are elongated thread like structure exhibited inside the nucleus of the cell. These…
Q: In detail explain the experiment that helped Hershey and Chase recognize DNA as a genetic material
A: Please follow step 2 for detailed explanation.
Q: COP
A:
Q: Amino Acid GUA 2 5 Amino Acid-Amino Acid Jeeeee decreet A A A
A:
Q: 16. What is the relationship between an organism's DNA and protein? DNA determines which RNA…
A: Introduction Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…
Q: During a mountain biking accident, your 45 year old sister and her excitable 14 year old daughter…
A: Introduction:- A broken bone also called as a fracture, is when a break goes through part or all of…
Q: Differentiate among between Northern, Southern and Western blotting techniques.
A: Answer Difference between Northern , Southern and Western blotting is under : 1) Northern blotting…
Q: How many NADH, FADH2, NADPH and ATP will be generated when breaking this fatty acid down into…
A: Fatty acids are broken down into acetyl-CoA by beta-oxidation within the mitochondrial matrix and…
Q: 19% dominant phenotype 0.19 = p2 + 2pq What is the dominant allele frequency?
A: The individual has two alleles for a gene. These are dominant and recessive alleles.
Q: Clary Leonhart used the pET vector system to express her prokaryotic amylase enzyme. added peptone…
A: i) Clary failed to obtain her protein of interest in this experiment because she forgot to induce…
Q: Cloning vectors are not just limited to bacterial plasmids. Bacteriophages and M13 phage vectors are…
A: Introduction :- A cloning vector is a short bit of foreign DNA that can be injected for cloning…
Q: QUESTION 37 A reservoir is O an environment that may contain various pathogenic microbes. O a living…
A: Introduction :- All living and non-living objects that occur naturally, or in this example, without…
Q: Percent Change in Weight (%) 10 5 0 -15 -20 -25 -30 Osmosis and it's Effect on Potato Weight Change…
A: Passive diffusion is a type of membrane transport mechanism in which substances moves from high…
Q: 1. Which of the following is true of a maternal effect? A) The gene is located in the nucleus. B) It…
A: Maternal effect produces when specific phenotypes of offspring are controlled by the factors that…
Q: Explain what structures you saw with fluorescence microscopy in lab, and what type of cells we used.
A: Introduction-- A fluorescence microscope is a optical microscope that uses fluorescence and…
Q: Where does hematopoiesis take place? spongy bone compact bone osteons outer…
A: Hematopoiesis can be defined as a process through which formation of all types of blood cells takes…
Q: Write a brief note on ethical usage of animal in pharmacological research? Please answer at your…
A: Animals are used in research to develop medicines and treatment techniques to address illnesses. As…
Q: According to the framework proposed by Blackburn et al. (2011), the term "invasive" applies to a…
A: Invasion biologists focused on various taxa and environments have adopted different model frameworks…
Q: DNAT A C C G C T C C G C C G T C G A C A A T…
A: The self-replicating biomolecules that are present in the chromosomes and carry genetic information…
Q: A cortical module found in the visual cortex represents what type of visual information? a. All of…
A: Visual cortex The major cortical area of the brain is where visual information conveyed from the…
Q: Consider the image below. This image shows plasmid DNA isolated through exactly the same method that…
A: Removing RNA is one of the crucial processes in plasmid purification, especially after the manual…
Q: The taxon Crocodilia includes crocodiles, Aves includes birds, and Squamata includes snakes and…
A: Monophyletic is a group of organisms which are classified in same taxon and will share the most…
Q: The initial rise in the membrane potential of an axon upon stimulation is called the...........…
A: MEMBRANE POTENTIAL: Membrane potential is difference between potentials of inner side and the…
Q: 2. Circle all inheritance patterns that you cannot rule out to explain this pedigree: a. autosomal…
A: Pedigree:- When the inheritance off particular character sticks or disease or any other health…
Q: is energy is released when ATP loses a phosphate group true about ATP and ADP
A: ATP is the energy currency of the cell and is made up of adenine and ribose sugar with three…
Q: 32. What are the two components of tRNA which are important for building a protein? what are…
A: Ribosomes are the one of the most essential organelle which is known for synthesis of proteins.…
Q: Complete ventricular filling occurs during what phase of the cardiac cycle? a. when the atria are…
A: The heart is the part of circulatory system. It pumps blood to various parts of the body.
Q: Questions A) what is the independent and dependent variable. B) what were the results of the…
A: Using three-dimensional computer animations of chimpanzees either yawning or with relaxed facial…
Q: Choose all the answers that apply. Where are osteoprogenitor (osteogenic) cells found?…
A: Introduction: Osteoprogenitor cells, sometimes termed to as osteogenic cells, are stem cells that…
Q: IV V Fig. 1 Disease pedigree in one family. Five generations I, II, III, IV and V are shown. Females…
A: Pedigree gives a major insight about the type of inheritance pattern either autosomal recessive or…
Q: Explain how this is related to increased breathing rate and depth (taking more and deeper breaths)…
A: We can breathe due to our respiratory system and lungs. They release carbon dioxide and inspire…
Q: Asexual reproduction provides a unique immune system to each human. Sexual reproduction is a fast…
A: please follow steps 2 & 3 for detailed explanation.
Q: 7. Using the diagram on the left, the molecule coded directly from DNA is represented by what…
A: Instead, the DNA is used to create a messenger RNA (mRNA) molecule, which then controls the…
Please label for me
Step by step
Solved in 2 steps with 2 images
- 1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate VS Savwas Rea lize NGSS ommunity/classes/da298ebd9 c514500827f97e044ab6ee8/assignments/2c3a 98df8d654edaab97cc6399 5c23fd/content/1ccf1054-b803-361d-b16a-8b4 G saint mother teresa. A Sa int Report K Maddox Bry ant - gr. Vs-nhm Growth lan's father keeps bees, and lan spends time observing their behavior. He is especially interested in bee communication and has even seen the waggle dance. The waggle dance communicates the location of food to other bees in the hive. All honeybees know the waggle dance from birth. Choose the correct words to complete the sentences. The waggle dance is an example of a(n) Choose... behavior, because bees can perform it correctly the first time. Bees exhibit Choose... Choose... ovide food and protection for the hive's young. learned predatory courtship instinctiveنقطة واحدة * intrinsic factor is serected by intrinsic factor O Parietal cells O Chief cells O G cells O !! هذا السؤال مطلوب
- can you help me with thses oneB BE -70 Membrane potential (mv) +35 A) A. B) B. C) C. D) D. E) E. C) D) D. C. D 2 Figure 37.1 30) In Figure 37.1, the period in which voltage-gated potassium channels are open and hyperpolarization has yet to occur is at label 3 A) A B) B C) C D) D Time (milliseconds) 31) In Figure 37.1, the membrane's permeability to sodium ions is at its maximum at label A) A. B) B. 4 32) In Figure 37.1, at what point in the graph are sodium channels closed (or closing) and potassiu channels opened? 33) In Figure 37.1, the neuronal membrane is at its resting potential at label A) A. B) B. C) C. D) D. E) EWhen there is a region of inflammation, the capillaries in that region are observed to be ___
- Twenty-year-old Kevin groaned and clutched his abdomen as he lay on the emergencyroom gurney. He had just been diagnosed with acute appendicitis and was waiting to betaken to the operating room (OR). Although he desperately wanted the pain to stop,Kevin was terrified of having general anesthesia. He hoped his fear wasn’t obvious to hisolder brother Cole, who was finishing medical school and thought he knew everything.“Hang in there,” Cole said, for what seemed like the eighteenth time. “I’m sure they’ll getyou upstairs as soon as they can. They don’t want that thing to burst.”Kevin grunted. “I know…but does that anesthesia stuff work all the time? How can I notwake up when someone’s slicing my gut open?”Cole assumed a professorial air, and Kevin wished he’d kept his mouth shut. However,Cole didn’t get a chance to say anything before an aide arrived to take Kevin to the OR.In the OR, someone placed a mask over Kevin’s face and when he blinked, he suddenlyfound himself in a hospital room…Twenty-year-old Kevin groaned and clutched his abdomen as he lay on the emergencyroom gurney. He had just been diagnosed with acute appendicitis and was waiting to betaken to the operating room (OR). Although he desperately wanted the pain to stop,Kevin was terrified of having general anesthesia. He hoped his fear wasn’t obvious to hisolder brother Cole, who was finishing medical school and thought he knew everything.“Hang in there,” Cole said, for what seemed like the eighteenth time. “I’m sure they’ll getyou upstairs as soon as they can. They don’t want that thing to burst.”Kevin grunted. “I know…but does that anesthesia stuff work all the time? How can I notwake up when someone’s slicing my gut open?”Cole assumed a professorial air, and Kevin wished he’d kept his mouth shut. However,Cole didn’t get a chance to say anything before an aide arrived to take Kevin to the OR.In the OR, someone placed a mask over Kevin’s face and when he blinked, he suddenlyfound himself in a hospital room…Twenty-year-old Kevin groaned and clutched his abdomen as he lay on the emergencyroom gurney. He had just been diagnosed with acute appendicitis and was waiting to betaken to the operating room (OR). Although he desperately wanted the pain to stop,Kevin was terrified of having general anesthesia. He hoped his fear wasn’t obvious to hisolder brother Cole, who was finishing medical school and thought he knew everything.“Hang in there,” Cole said, for what seemed like the eighteenth time. “I’m sure they’ll getyou upstairs as soon as they can. They don’t want that thing to burst.”Kevin grunted. “I know…but does that anesthesia stuff work all the time? How can I notwake up when someone’s slicing my gut open?”Cole assumed a professorial air, and Kevin wished he’d kept his mouth shut. However,Cole didn’t get a chance to say anything before an aide arrived to take Kevin to the OR.In the OR, someone placed a mask over Kevin’s face and when he blinked, he suddenlyfound himself in a hospital room…
- Importance Discase/Illness if there is any malfuntion of the organs Respiratory System 1. Lungs 2. Nose 3. Trachea 4. Diaphragm 5. Intercostal Muscle 6. Pharynx 7. Larynx 8. Bronchi 1. Mouth 2. Esophagus 3. Stomach 4. Small Intestine 5. Large Intestine 6. Anus Digestive System Urinary System 1. Kidneys 2. Renal Pelvis 3. Ureters 4. Bladder 5. Urethra Immune System 1. Thymus 2. Bone Marrow 3. Lymph Nodes 4. Vessels 5. SpleenA B C D E F G H I J K bone esophagus gall bladder hair heart kidney liver lung lymphatic vessels muscle pancreas pituitary gland spinal cord spleen stomach thyroid gland trachea ureter urethra uterusA malignancy involving the lateral aspect of breast would most likely metastasize first to which of the following groups of nodes? ● Axillary nodes Deep pectoral nodes O Abdominal nodes Cervical nodes Parasternal nodes